summaryrefslogtreecommitdiffstats
path: root/dat
diff options
context:
space:
mode:
authorJason Linehan <patientulysses@gmail.com>2015-08-25 07:09:28 -0400
committerJason Linehan <patientulysses@gmail.com>2015-08-25 07:09:28 -0400
commit70a4d1c7c4e3c2bf4a89e6a21bcaa4277db9544d (patch)
tree2e968fbf629317ee9c5478be2f73c1600c60e3f3 /dat
downloadhug-70a4d1c7c4e3c2bf4a89e6a21bcaa4277db9544d.tar.gz
hug-70a4d1c7c4e3c2bf4a89e6a21bcaa4277db9544d.tar.bz2
hug-70a4d1c7c4e3c2bf4a89e6a21bcaa4277db9544d.zip
First commit
Diffstat (limited to 'dat')
-rw-r--r--dat/catcsf.txt486
-rw-r--r--dat/csf.txt243
2 files changed, 729 insertions, 0 deletions
diff --git a/dat/catcsf.txt b/dat/catcsf.txt
new file mode 100644
index 0000000..0701807
--- /dev/null
+++ b/dat/catcsf.txt
@@ -0,0 +1,486 @@
+>gi|669032233|ref|NC_024607.1| Corvus splendens mitochondrion, complete genome
+GTCCATGTAGCTTACAATAAAGCATGACACTGAAGATGTCAAGACGGCTGCCACAAACACCCATGGACAA
+AAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCCAGAATTATACATGCAAGTATCCGCATTCCAGTGTA
+AATGCCCTAGGCACCCTTTAACCAAGTCGATAGGAGCGGGTATCAGGCACACACAATTGTAGCCCAAGAC
+GCCTTGCACTTGCCACACCCCCACGGGTATTCAGCAGTGGTTAACATTAAGCAATGAGTGTAAACTTGAC
+TTAGTCATGGCAACCTTAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACTCAAATT
+AACAGTATAACGGCGTAAAGGGTGGTAACATGCTATCTAAGTAACTAAGATTAAAAAGCAACTGAGCTGT
+AATAAGCCCAAGATGCTCATAAGGCCAACTACCAAAGAAGATCTTAGACTGACGATTAATTGAAATCCAC
+GAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCTCTATGCTA
+CCTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACC
+CACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCACTCCTTGCTGAATCAGCCT
+ACATACCGCCGTCGCCAGCCCACCCCCCCTGATGGTTCAACAGTGAGCGCAATAGTCCCTACCCACTAGT
+AAGACAGGTCAAGGTATAGCCCATGGAGTGGAAGTAATGGGCTACATTTTCTAGTTTAGAACATCACGGC
+AAAAGGGTCTGAAATGGCCCTTAGAAGGCGGATTTAGCAGTAAAGTGGGACAATCGAGCCCTCTTTAAGC
+CGGCTCTGGGATGCGTACATACCGCCCGTCACCCTCCTCACAAGCGACCCAAACCCCCCAATACATTAAT
+ACGCTATCCAGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACAACCA
+AGACGTAGCTTAGACGAAAGCATTCAGCTTACACCTGAAAAACATCTGCTAACACCAGATCGTCTTGATG
+CCAAATTCTAGCCCAACCACATTGACCTGGAATAACAAAGCTACTACATACACCAAACTAAAGCATTCAC
+TAGTCTTAGTATAGGCGATAGAAAAGACACCAATTGGAGCGATAGAGATCACGTACCGTAAGGGAAAGAT
+GAAATAATAATGAAAAAACTAAGCTATAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTA
+GCAAGAAAAACCAAGCAAAATGAGTTTAAGTTTGCCACCCCGAAACCTAAGCGAGCTACTTGTGAGCAGC
+TATTGTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGACGACTTACTAGTAGAGGTGAAAAGCCAATC
+GAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAACTA
+ATAGAACCCTAATGAAGCGAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATC
+TCTACGAGCGGATAAATAATCTATAGAAAGATTTCCTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGC
+GTTAAAGCTCTTCGACTAAAAAATATAAGAACTTCATGACTCCCTCATCATTAACAGGCTAACCTATATG
+TAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGGTCCTCCCTCTACGACGCAAGCTTACATCTTTAC
+ATTATTAACAAATCACCAAGATACGACAAATCAAACAAGCAGAGTATCAGGTAAATTGTTAACCCGACAG
+AGGAGCGTCCATTAAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACATCAAGGCCCGACTGTTT
+ACCAAAAACATAGCCTTCAGCAAACAGCAAACAAGTATTGAAGGTGATGCCTGCCCTGTGACTTAGTGTT
+TAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGGGACCAGTATGA
+ATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGG
+GATAACTACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACCCCTACACACATTCACTC
+CCACTGGGTACACGCTCATACAGGGAACTGGCCTGCATTTTTCGGTTGGGGCGACCTTGGAGAAAAACAA
+ATCCTCCAAAAATTAGACCACAACTCTAGACTGAGAGCGACCCCTCAACGTGCGAATAGCACCCAGACCC
+AATATAATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGA
+CGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTT
+GTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCCATCTATGA
+TGAACTCTTCCCAGTACGAAAGGACAGGAAAAGTGAGGCCAATACTACAAGCAAGCCTTCGCCTTAAGTG
+ATGAATCCAACTAAATTACGAAAGGCTATCACACTACAACCATGTCCTAGAAAAGGACTAGCTAGCGTGG
+CAGAGCTCGGAAAATGCAAAAGGCTTAAGTCCTTTATATCAGAGGTTCAAATCCTCTCCCTAGCTAAACT
+TAAAATGGCCAACTATCCCATCCTAGTCAACCTCATTATAGCACTTTCTTATGCCATCCCCATTCTAATT
+GCCGTAGCCTTTTTAACCCTAGTAGAACGTAAAATCCTAAGTTACATACAAGGCCGAAAAGGGCCCAACG
+TTGTAGGCCCTTTCGGGCTCCTGCAGCCAGTAGCAGATGGGGTAAAGCTATTCATCAAAGAACCAATCCG
+CCCATCAACATCCTCCCCAATTCTATTTATTACCACCCCAATACTAGCCCTCCTACTAGCAATCTCCATC
+TGAACCCCACTTCCAATCCCATTCCCACTTGCAGATCTAAACCTAGGACTGCTATTCATATTAGCCATGT
+CAAGCCTAGCAGTATACTCAATCCTATGATCTGGCTGAGCCTCCAACTCAAAATACGCCCTAATCGGATC
+TCTACGGGCAGTAGCCCAGACAATTTCATACGAGGTCACCCTAGCAATCATCCTACTATCCATCATCCTT
+CTCAGTGGAAATTATACTCTAAGCACCCTAGCAGTTGTTCAAGAGCCCCTATTTCTTATCTTCTCCTGCT
+GACCCCTCGCCATAATATGATATGTATCTACACTGGCCGAAACAAATCGTGCCCCATTCGACCTCACAGA
+AGGGGAATCAGAACTAGTCTCAGGATTCAACGTAGAATATGCCGCAGGGCCCTTCGCTTTATTCTTCCTA
+GCAGAATACGCGAACATCATGCTCATAAACGCACTAACCGTAATCCTGTTCTTCAACCCAAGCCTATACA
+ATCCACCTCAAGAACTCTTCCCCGTAATTCTAGCCACAAAAGTCCTACTCCTGTCCATAGGATTCCTATG
+AATTCGTGCCTCCTACCCACGATTCCGATATGATCAGCTAATGCATTTACTATGAAAAAACTTCCTCCCA
+CTAACGCTCGCTCTATGTCTGTGACACATTAGCATACCAATTTCCTACGCAGGCCTACCTCCTTACCTAA
+GGAGCCACCAGGAAATGTGCCTGAACGTCAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAG
+CCCTCTCATTTCCTACACCTTAGAAAAACAGGAATCGAACCTGTACAAGAGAGATCAAAACCCTCCATAC
+TTCCTTTATATTATTTTCTAGTAGGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTT
+TAACCCCTTCCCCTGCTAATGAACCCCCAGGCAAAACTGATTTTTATCACTAGCCTACTCCTAGGAACAA
+CCATCACAATTTCAAGCAACCATTGAGTCATGGCCTGAACCGGCCTTGAAATCAACACACTCGCTATTCT
+GCCCCTAATTTCAAAATCCCACCATCCCCGAGCTATTGAGGCAGCAACCAAATATTTTCTAGTTCAAGCA
+ACTGCCTCAACTCTGGTACTATTCTCCAGCATAACCAATGCATGGTACACTGGGCAATGAGATATCACCC
+AGCTAACCCACCCAGCATCCTCCCTAATCCTAACCGCAGCTATTTCAATGAAGCTTGGACTAGTACCCTT
+TCACTTCTGATTCCCAGAAGTCCTACAAGGCTCCCCCCTCATTACTGGCCTTCTCCTGTCCACAGCCATG
+AAATTTCCACCAATTACCCTACTCTACATAACCTCCCTATCCCTAAACCCCACACTACTAACCACCCTGG
+CCGTTCTTTCTGTAGCCATAGGAGGCTGAATAGGACTAAACCAAACACAAGTCCGAAAAATTATGGCCTT
+CTCCTCTATCTCACACCTAGGCTGAATGGCCATTATCTTAATCTACTACCCCAAACTTACTCTACTCAAC
+TTCTACCTGTATGCCATAATAACCGCTGCCGTATTCCTAACCCTAAACTCAATAAAAGTCCTAAACCTAT
+CCACACTAATAACTGCATGAACAAAAGCACCTGCACTTAGCACAATCCTCCTACTAACACTTCTGTCCCT
+GGCCGGCCTCCCCCCTTTAACCGGCTTCCTCCCAAAATGACTCATTATTCAAGAACTAACCAAACAGGAC
+ATAGCTCCGGCAGCAATTATTATCTCCCTTCTTTCACTACTGGGTCTCTTCTTCTACCTCCGTCTTGCGT
+ATTGTGCAACAATCACACTTCCGCCCCACACAACAAACCACATGAAACAATGACGTACCAACAAACCAGT
+TAGCCCCTCAATTGCCATTTTAACAACCCTATCCATCATGCTCCTCCCAACTTCCCCCATACTCACTACC
+ATTATTTAAAGAGAAACTTAGGTTTACTGAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCT
+CTTAGTTTCTGTTAAAATCCGCAGGACGTTATCCTGCATCTTCTGAATGCAACTCAGATGCTTTAATTAA
+GCTAGGATTTTGCACCTCTAGACAGATGGGCTTCGATCCCATGATACTATAGTTAACAGCTATATGCCCT
+AAACCAACAGGCTTCTGCCTAACAGACTCCGGTGCACTGTCAGTGCACATCGATGAGCTTGCAACTCACC
+ATGAACTTCACTACAGAGCCGATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT
+ATACACTCAGCCATCTTACCCGTGACTTTCATCAACCGATGACTATTCTCAACCAACCACAAAGACATTG
+GCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATTCGAGC
+AGAACTGGGCCAACCAGGTGCTCTACTAGGAGATGACCAAATCTACAATGTAATCGTCACAGCTCATGCC
+TTTGTCATAATTTTCTTCATAGTTATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTTCCACTAA
+TGATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCACCCTCATT
+CCTCCTACTTCTAGCTTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTG
+GCTGGTAACATAGCCCATGCTGGAGCCTCAGTTGACCTTGCAATCTTCTCACTACACCTAGCAGGTATTT
+CTTCCATCCTAGGAGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATA
+TCAAACCCCCCTATTCGTATGATCCGTACTAATTACCGCAGTACTGCTCCTTCTCTCCCTACCCGTACTT
+GCTGCCGGAATTACTATGCTTCTAACAGACCGTAACCTCAATACCACATTCTTCGACCCAGCAGGAGGAG
+GAGACCCGGTACTATACCAGCACCTGTTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTACC
+AGGATTTGGTATTATTTCTCACGTCGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGA
+ATAGTATGAGCCATGCTATCCATCGGGTTCTTAGGCTTCATCGTTTGAGCACACCACATGTTTACAGTCG
+GAATGGACGTAGACACTCGAGCATACTTCACATCCGCCACCATAATCATTGCCATCCCAACCGGAATCAA
+AGTGTTCAGCTGACTGGCAACTCTTCACGGAGGAACAATCAAATGAGATCCACCAATGCTGTGAGCCCTA
+GGATTCATCTTCCTCTTCACTATTGGTGGACTAACAGGAATTGTCCTAGCAAACTCCTCCCTAGACATTG
+CCCTACACGACACTTACTACGTAGTAGCTCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAAT
+CCTAGCAGGATTTACCCACTGATTCCCACTATTCACCGGATACACCCTACACTCTACATGAGCTAAAATC
+CACTTCGGGGTGATATTCGTAGGAGTAAACCTTACTTTCTTCCCACAACACTTCCTTGGACTAGCTGGCA
+TGCCACGACGATACTCAGACTACCCAGACGCCTACACTCTATGAAACACTATCTCATCAGTAGGATCACT
+AATTTCCCTAACCGCCGTAATCATGCTGATATTTATCATCTGAGAAGCTTTCGCATCCAAACGTAAAGCC
+CTACAGCCAGAACTAGTCAATACAAACGTCGAATGAATCCACGGCTGCCCACCACCATTCCACACATTCG
+AAGAACCAGCCTTCGTTCAAGTTCAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACC
+GCATAAACCACTTATGCTTCTTTCTCATTTAGAGGTGTTAGTAAAACTATTACATAGTCTTGTCAAGACT
+AAATTACAGGTTAAAGCCCAGTACACCTCAACACAAATATGGCCAACCACATACAATTCGGTTTTCAAGA
+CGCTTCATCCCCTATCATAGAAGAACTAGTAGAATTTCACGACCACGCTCTAATAACTGCCCTAGCTATT
+TGCAGCCTGGTACTATACCTACTAACCATGATACTCACCGAAAAGCTATCATCCAGCACAGTCGATGCAC
+AAGAAATCGAACTTGTCTGAACAATCCTCCCTGCAATTGTCCTAATCATGCTTGCTCTACCATCCCTACA
+AATCCTCTACATAATGGATGAAATTAACGAGCCCGACCTGACACTAAAAGCCATTGGACACCAATGATAC
+TGATCTTACGAATACACCGACTTCAAGGACCTAACATTTGACTCTTACATGACACCAACTGCAGACCTAC
+CGTTAGGTCACTTCCGACTACTAGAAGTGGACCATCGTGTAGTTGTCCCAATGGAATCACTAGTTCGAGT
+CATCGTTACTGCCGACGACGTACTTCACTCATGAGCCGTCCCAAGCCTAGGCGTAAAAACTGACGCAATC
+CCAGGACGACTGAACCAAACCTCATTCACCGCCACTCGACCTGGAGTATTCTACGGTCAATGCTCAGAAA
+TTTGTGGGGCTAATCACAGCTTCATACCAATTGTAGTTGAATCTGCTCCACTCGCCAATTTCGAGAACTG
+ATCCTCTCTACTATCATCTTAATCATTAAGAAGCTATGAACCAGCGCTAGCCTTTTAAGCTAGAGAAAGA
+GGACTATTCATCCTCCTTAATGATATGCCTCAACTAAACCCAAACCCATGATTTTTTATCATGCTAGCTT
+CGTGACTCACCTACTCCATAATCATCCAACCTAAACTACTATCCTTTGTCTTCATAAACCCTCCAATCAG
+CAAAACCCAAACAACCCCAACCACCTCCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCT
+CAAGCCCATCCCTACTAGGTATTCCCCTAATCCTGATCGCAATAACATTCCCTGCCCTCCTGCTGTCAAC
+CCAAAACAACCGATGAATCACTGATCGCCTATCCACTTTACAATCATGATTCATCAGCCTAATTACAAAA
+CAGCTGATAATGCCACTAAGCAACAAGGGACATAAATGAGCCCTAATCCTAACATCGCTAATACTATTTC
+TCCTACTTATCAACCTGCTAGGCCTACTACCCTACACATTCACCCCAACAACCCAACTTTCTATAAACCT
+AGCTCTAGCAATTCCCCTATGACTTGCCACCCTGCTCACAGGACTACGAAACCAACCCTCAATCTCCCTA
+GCCCACCTCCTACCAGAAGGAACCCCAACTCCACTAATCCCAGCCCTAGTCCTCATTGAAACAACTAGCC
+TTCTTATTCGTCCCCTAGCCCTAGGCGTTCGCCTTACAGCCAACCTCACAGCAGGCCATCTATTAATCCA
+ACTTATCTCAACAGCCACTGCCTCCCTAGTCTCAACAATACCAATAATCTCACTACTAACATTATTAGTA
+TTATTCCTACTCACAGTCCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTATTTGTGCTACTACTAA
+GCCTGTATCTACAAGAAAACATTTAAACCACCAATGACTCACCAAGCACACTCTTATCACATAGTTGACC
+CAAGCCCATGACCCATCCTAGGAGCAGCCGCTGCTCTTCTTACTACATCCGGCCTAACCGTATGATTCCA
+CTACAACTCGCCATACCTACTGATCATAGGACTAACTTCTACTGCCCTGGTTATACTTCAATGATGACGT
+GACATCATCCGAGAAAGTACATTCCAAGGCCACCACACACCCACAGTACAAAAAGGCCTACGATATGGAA
+TAGTCCTATTCATCACATCAGAGGCCTTCTTCTTCCTAGGTTTCTTTTGAGCATTCTTCCACTCCAGCCT
+GGCCCCAACACCAGAGCTAGGAGGACAGTGACCTCCAGTCGGAATCAAACCTCTAAACCCAATGGACGTC
+CCCCTCCTAAACACCGCCATCCTACTTGCTTCAGGAGTCACAGTCACATGAGCACACCATAGCATCATAG
+AAGCTAACCGAAAACAAGCAATCCACGCCCTCACCCTTACAGTTCTCCTAGGCTTCTACTTCACCGGCCT
+GCAAGCCATAGAATACTACGAAGCTCCGTTCTCCATCGCTGACGGGGTATACGGTTCTACCTTCTTCGTA
+GCAACTGGCTTCCACGGCCTCCACGTAATCATTGGTTCCACATTCCTCCTAGTATGCCTTCTACGCCTAA
+TCAAATACCACTTTACACCAAAACACCATTTTGGCTTCGAAGCAGCAGCTTGATACTGACACTTTGTAGA
+CGTCGTATGACTATTCCTCTATATGACTATCTACTGATGAGGATCCTACTCTTCTAGTATATTAATTACA
+ATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATGAACATAATCCTATTCATAATA
+GTCTCATCTTTAACTCTAAGTGTCATCCTCACTGCATTAAACTTTTGACTAGCACAAATAAACCCAGACT
+CAGAGAAACTGTCCCCATACGAATGTGGATTTGACCCACTAGGGTCCGCCCGGCTGCCATTTTCAATTCG
+ATTTTTCCTAGTTGCAATCTTATTTTTACTATTTGACCTAGAAATTGCTCTGCTCCTTCCACTACCATGA
+GCCATCCAGCTACAAACCCCCACCCTTACACTAACATGGGCCTCCATCCTTATTCTTCTCCTTACTCTAG
+GTCTGGTTTATGAATGAAGCCAAGGAGGACTAGAATGAGCAGAATAACAGAAAGTTAGTCTAACCAAGAC
+AGTTGACTTCGACTCAACAGATTATAGCTAACGCCCTATAACTTTCTTAATGTCTGCCCTACAATTAAGC
+TTTTTTTCCGCCTTCACCCTAAGCGGCCTAGGCCTAGCCTTCCACCGCACACACTTAATCTCCGCCCTAC
+TATGTCTAGAAAGTATGATACTATCCATATACGTCGCCCTTTCCATGTGACCAATCCAGACCCAAACAAC
+ATCTGCTACCCTCCTACCACTTCTCATACTAGCATTCTCTGCTTGTGAGGCAGCAACAGGCCTAGCTCTA
+CTAGTCGCCTCCACCCGGACCCACGGCTCCGACCACCTGCACAACTTTAACCTACTACAATGCTAAAAAT
+CATTATTCCAACCATCATACTCCTACCACTGACCTTCCTCTCCCCCTACAAACACCTATGAACTAACACC
+ACAACACACAGCCTATTAATTGCCGCTGTCAGCCTCCAATGACTAGTCCCAACATACTACCCAAGCAAAG
+GACTAACCCATTGAACCTCAATTGACCAAATCTCCTCCCCCCTACTAGTTCTATCGTGCTGACTACTCCC
+ACTCATACTCATAGCAAGCCAAAACCACCTAGAACAAGAGCCAATCATCCGTAAACGAATCTTCATCACA
+ACTATAATCACAGTACAGCCCTTTATCCTGCTGGCTTTCTCAGCTTCAGAACTAATACTATTCTACATCG
+CATTTGAAGCAACCCTAATTCCAACCCTAATCCTTATCACACGATGAGGAAACCAACCCGAACGACTGAA
+CGCAGGCATTTACCTGCTATTTTATACACTCGCCAGCTCTCTTCCTCTGCTGATCACAATCCTCCACCTA
+CATAACCAAATTGGCACATTATACCTCCCTATACTCAAACTATCGCACCCAACAATAAACAACTCTTGAA
+CAGGCCTACTAGCAAGCTTAGCCCTCCTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGTCTTCATCT
+ATGACTCCCAAAAGCACATGTAGAAGCCCCAATCGCCGGATCCATGCTACTAGCCGCTCTCCTCCTAAAA
+CTTGGCGGCTACGGCATTATACGAATCACTATCCTAGTAAACCCCTCTGTAAACAACCTACACTACCCAT
+TCATTACTTTAGCACTATGAGGAGCAGTAATAACCAGTGCCATCTGCCTACGACAAATCGACCTAAAGTC
+CCTAATTGCTTACTCCTCTGTAAGCCATATAGGACTAGTCATCGCCGCAACCATAATTCAAACCCAATGA
+GCCTTCTCAGGGGCAATAATCCTAATAATCTCTCACGGCCTAACCTCCTCTATACTATTCTGCCTGGCCA
+ATACAAACTACGAACGAACTCACAGCCGAATCCTACTTCTAACCCGAGGACTTCAACCCCTCCTACCACT
+TATGGCCACCTGATGACTACTAGCAAACCTAACAAACATGGCACTACCACCAACAACCAACCTCATAGCA
+GAACTAACCATTGTAGTAGCCCTGTTCAACTGATCCCCACTGACAATCATTTTAACAGGAACTACAATCG
+TACTAACTGCCTCTTATACCCTACATATGCTAATAACAACACAACGAGGAATACTACCATCCCACATCAC
+CTCAATCCAAAATTCCTCAACACGAGAACATCTCCTGATGGCCCTACACATAATTCCCATAATCCTACTT
+ATTCTCAAACCTGAACTAATCTCAGGAATCCCTATATGCAAGTATAGTTTAATCAAAACATTAGATTGTG
+ATTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGGAGGTTAAACCAACAAGAACTGCTAATTC
+TTGCATCTGAGTATAAAACCTCAGCCCCCTTACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAAC
+CAGTCATCTTGGTGCAAATCCAAGTGAAAGTAATGGACCAAATACTTATCCTAAACACATTCATACTACT
+CACCCTAGCAGTACTCTGCACCCCAATCATCTTCCCCATACTATCAAGCAGCCTAAAAAACACTCCAACT
+ATCATTACAAACACTGTCAAAACTTCCTTCCTAATCAGCCTGATCCCCATAACCATCTACATTCACTCAG
+GAATAGAAAGTCTAACTTCCTTCTGGGAATGAAAATTCATTATAAACTTTAAAATTCCTATCAGCCTAAC
+AATAGACTTCTACTCACTGACTTTCTTCCCAATTGCCCTATTTGTCTCCTGATCAATCCTACAATTTGCA
+ACATGATACATAGCCTCAGACCCGCACGTCGCAAAATTTTTCACCTTCCTCCTCCTATTCCTTATTGCCA
+TGCTCATCCTGATTATCTCCAACAACCTGTTCCTACTCTTCATCGGATGAGAAGGAGTAGGAATCATATC
+CTTCCTACTAATCAGCTGATGACATGGCCGAGCAGAAGCAAATACCGCTGCCCTACAGGCCGTACTATAC
+AACCGAGTCGGAGATGTAGGCCTTATCCTGTGCATGGCATGACTAGCTTCCACCATAAACACATGAGAAA
+TTCAACAAATCTCATCTCAGGACCAAACTCCTACCCTACCACTACTAGGCTTAATTTTAGCTGCGGCCGG
+CAAATCCGCCCAATTTGGCCTCCACCCGTGACTCCCAGCAGCAATAGAAGGCCCAACCCCTGTATCCGCC
+TTACTTCATTCCAGCACCATAGTAGTCGCCGGGATCTTCCTACTTATCCGAACTCACCCCCTCTTCCACA
+ACAACCCCACTGCACTATCACTATGCCTATGCCTGGGAGCCCTCTCCACACTATTCGCAGCCACTTGCGC
+CCTGACCCAAAATGATATCAAAAAAATCATTGCTTTTTCCACATCCAGCCAACTAGGCCTAATAATAGTT
+ACAATCGGCCTAAATCTTCCCCATCTAGCCTTCCTGCATATTTCAACCCACGCATTCTTCAAAGCCATGC
+TATTCCTATGTTCAGGGTCAATCATTCACAGCCTCAACGGCGAACAAGACATTCGAAAAATAGGAGGACT
+TCAAAAAATACTACCAACAACAACCTCATGCCTAACTATCGGAAACCTAGCCCTGATAGGAACACCATTT
+CTGGCAGGATTCTACTCCAAAGACCAAATTATCGAAAGCCTCAACACCTCGTACTTAAACGCTTGAGCCC
+TAGTTCTAACTCTCCTAGCTACATCATTCACCGCAGTATATACTATTCGAATAACCCTATTAGTTCAAAC
+AGGATACGTCCGAATTCCTCCCCTAACCCCCATGAACGAAAATAACCCAGCAGTCCTCTCCTCAATCACT
+CGACTTGCACTAGGAAGCATTGTAGCAGGATTCCTAATCACCTCATATATTCCACCTGCAAAAACCCCAC
+CAATAACTATACCACTATCCATTAAAGTCACGGCCCTTGTAGTAACACTACTAGGAATCATCCTAGCCCT
+AGAACTCTCAAAACTAACTCAAGCTTTAATCCTCCCTAAACAGAATCGCTTCTCAAATTTCTCTACAGCC
+CTAGGATACTTTAATCCCCTAGTACACCGATTTATCCCAACAAAAATACTAAGCGGCGGCCAAAACATTG
+CCTCCCACCTAATTGACCTCTCTTGATTCAAACTTCTAGGCCCTGAAGGGTTAGCCAACCTACAAATAAT
+AGCATCAAAAACCGCTACCTCCTTCCACACAGGCCTAATTAAAGCCTACCTAGGATCATTTGCCTTATCA
+ATCTTTATCATCCTCCTATCCACATACAGAACCAAACTTAATGGCCCTAAATCTACGAAAAAATCACCCA
+CTACTAAAAATCATCAACAACTCCCTAGTTGACCTTCCCACTCCATCAAACATTTCAGCTTGATGAAACT
+TCGGATCCCTACTAGGCCTATGCCTCATCACACAAATTGTCACAGGCCTACTACTAGCCATACATTACAC
+AGCAGACACCTCCCTAGCCTTCGCTTCCGTAGCCCACATATGCCGAGACGTACAATTCGGATGACTAATC
+CGAAACCTCCACGCAAATGGGGCCTCCTTCTTTTTCATTTGCATCTACCTACATATTGGCCGAGGATTCT
+ATTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTAGTCCTTCTTCTAACACTAATAGCAAC
+TGCCTTCGTAGGATACGTCCTGCCATGAGGACAAATATCTTTCTGAGGAGCTACAGTCATTACAAACCTT
+TTCTCAGCAATCCCATACATTGGACAAACATTAGTAGAATGACTATGAGGCGGGTTCTCAGTAGACAACC
+CCACACTAACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTGTAATCGCAGGCCTGACACTAGTACA
+CTTAACCTTCCTCCACGAAACAGGCTCAAACAACCCACTAGGAATCCCCTCAGATTGCGACAAAATTCCA
+TTCCACCCTTACTACTCCATCAAAGACCTACTAGGATTCGCACTAATACTCGTCCCATTCGTCACTCTGG
+CCCTATTTTCCCCAAACCTCCTAGGAGACCCAGAAAATTTCACGCCCGCCAACCCCCTGGCCACACCTCC
+CCACATTAAACCCGAATGATACTTCCTATTTGCATACGCCATTCTCCGATCCATCCCAAACAAACTAGGA
+GGAGTCCTAGCTCTAGCCGCCTCAGTCCTAGTCCTATTCCTAATACCTCTCCTCCACACGTCTAAACAAC
+GTTCCATAACCTTTCGACCCCTATCACAAATCCTATTCTGAGCTCTAGTCGCAGACCTCTTCATCCTAAC
+ATGAGTAGGAAGCCAACCAGTCGAACACCCATTCATCATCATTGGCCAACTAGCCTCCTTCACCTACTTC
+GCAATCATCCTAATCCTGTTCCCTATCGCGAGTGCACTAGAAAACAAAATACTAAAACTCTAATCAACTC
+TAATAGTTTATAAAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACATCTTCTTAGAGTTAACAC
+ATAAATCAGAAAGAAAGGAGTCAAACCTTTATCACCAACTCCCAAAGCTGGCATTCTCAATTAAACTACT
+CTCTGACCTACCAATTAAACCGCCCGAATTGCCCCCCGAGATAACCCCCGCACAAGTTCTAAAACCACAA
+ACAGTGTTAATAACAGGCCTCATCCTGCAATTAAAAGCAGCCCTGACCCAGACGAATAGAACATAGCTAC
+TCCACTAAAATCCGTCCGAGTTCACGATAGACCTCCATTATTCACCGTATCCCCTCCCATAATCACTTCA
+GAAAACACCCCTGTAGCAAACCCCACAATAACAACGACTAACCCCAGACCAACACCATAACCAACAACCC
+GTCAATCACCCCAAGATTCCGGATAAGGATCCGCTGCCAGAGACACTGAATAAACAAATACCACCAGCAT
+CCCCCCTAAATATACCATCACCAGTACAAGAGAAACAAAAGAAACCCCCATACTTACCAGTCACCCACAT
+CCAGCAATAGAAGCCACAACCAGACCCACCACCCCATAATAAGGAGAAGGGTTAGACGCAACCGCTAACC
+CTCCTAAAACAAAGCATAGACTCATAAAAAGAACAAAGTTTATCATAGTTCCTGCTTGGATCCTCCCCAA
+GACCTATGGCTTGAAAAACCATTATTATAAAACTTTAACTACAGGAACTAAACCCTACTCTCATCCACCC
+CCCCCCCTTACCCCCCCCATGTTTTTACATGGGATTTTGGCTATGTATTTCTTTGCATACAATTCTCGTC
+CACATTAGACATAATATGCATGTAGGATAACTCACATAACAAGTAATGCAAGACCTAACCAAACTCAAAT
+ATCATCGCCCATAACACCCCAAACGGACAGATAACCTTCCAGGCACATCCCCATCGCAGGCACAACAAAC
+CCAGGTAATCCTACCAACGACACAAGACAAGCTTCGCCCAAGATCGAGAATGTTTTACCTTACATAACAA
+CGCACTCTCGTAAACGAGGAATATCCTAGTACCCCAATGAATTCTTAATCCCATACGTTTCAGTCCATCA
+CCACAAAACCTCCTAGTCCTATCACTCTCAAGAGCTCCCAAGAAGGACCTGGTTATTTATTAGTCGTAAT
+CCTCACGAGAACCGAGCTACTCAACGTAGGTGCTACCCACGGCTACCAGCTTCAAGGCCATACTTTCCCC
+CTACACCCTCGCCCAACTTGCGCTTTTGCGCCTCTGGTTCCTATTTCAGGGCCATAACTTGGACCTTTCC
+CTCCTTATCGCTCTTCACAGATGCAAGTGGTCGGATGCATAATCCTCCCTTTGCCTCGTGATCGCGGCAT
+CCGACCGACTTGGCGCTTGTTTTCTTTTTGGGGTCTCTTCATTAAACCCTTCAAGTGCGTAGCAGGAGTT
+ATCTTCCTCTTGACGTGTACATCACATGGCATCCGAGCGGCTATTTGTCTGTAATGTACCTGGTGTCATG
+GTTGTTCGGATAAGGTCGTCTCAAACTTGACACTGATGCACTTTTACCCCATTCATGGTGGGTCCCCCAG
+CTACCTATACGGTGGCAGATAATGTTATGGTTGCCGGACATAGTTTGTTATTTTTCCTTTACTAGGAATT
+ATCACCCAAACCTTCATTTTCATTCTTTTTTTTATCGTTTATTTTTATGTTGTAATTTTAACAAAATAAA
+CAACAACTTTTATATGATATTAACCTAGATTTTCCAAACCATTCATCGTTCGTTCATTAACACTTAACTT
+TCCTCTGCCTTTCCCCTATTTTTAACCCAACAAATCAATGACTTTCATCATAACTTCCACAACCACCAAC
+TTAGCCAAATTACACAAAACAAACAAACCAATTAAAAACAAGATAAAAGTACACACCCTTTACACACAAC
+CACACTAAACACACAACAAAACTTAACACACTATATGCCACAATACTACTTTTCATTTATAAAAAAAACA
+AGATAAAAATACAAAACATCAATACCAATAATAAGTCCAAAATACTACATTCGCTT
+>gi|669032233|ref|NC_024607.1| Corvus splendens mitochondrion, complete genome
+GTCCATGTAGCTTACAATAAAGCATGACACTGAAGATGTCAAGACGGCTGCCACAAACACCCATGGACAA
+AAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCCAGAATTATACATGCAAGTATCCGCATTCCAGTGTA
+AATGCCCTAGGCACCCTTTAACCAAGTCGATAGGAGCGGGTATCAGGCACACACAATTGTAGCCCAAGAC
+GCCTTGCACTTGCCACACCCCCACGGGTATTCAGCAGTGGTTAACATTAAGCAATGAGTGTAAACTTGAC
+TTAGTCATGGCAACCTTAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACTCAAATT
+AACAGTATAACGGCGTAAAGGGTGGTAACATGCTATCTAAGTAACTAAGATTAAAAAGCAACTGAGCTGT
+AATAAGCCCAAGATGCTCATAAGGCCAACTACCAAAGAAGATCTTAGACTGACGATTAATTGAAATCCAC
+GAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCTCTATGCTA
+CCTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACC
+CACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCACTCCTTGCTGAATCAGCCT
+ACATACCGCCGTCGCCAGCCCACCCCCCCTGATGGTTCAACAGTGAGCGCAATAGTCCCTACCCACTAGT
+AAGACAGGTCAAGGTATAGCCCATGGAGTGGAAGTAATGGGCTACATTTTCTAGTTTAGAACATCACGGC
+AAAAGGGTCTGAAATGGCCCTTAGAAGGCGGATTTAGCAGTAAAGTGGGACAATCGAGCCCTCTTTAAGC
+CGGCTCTGGGATGCGTACATACCGCCCGTCACCCTCCTCACAAGCGACCCAAACCCCCCAATACATTAAT
+ACGCTATCCAGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACAACCA
+AGACGTAGCTTAGACGAAAGCATTCAGCTTACACCTGAAAAACATCTGCTAACACCAGATCGTCTTGATG
+CCAAATTCTAGCCCAACCACATTGACCTGGAATAACAAAGCTACTACATACACCAAACTAAAGCATTCAC
+TAGTCTTAGTATAGGCGATAGAAAAGACACCAATTGGAGCGATAGAGATCACGTACCGTAAGGGAAAGAT
+GAAATAATAATGAAAAAACTAAGCTATAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTA
+GCAAGAAAAACCAAGCAAAATGAGTTTAAGTTTGCCACCCCGAAACCTAAGCGAGCTACTTGTGAGCAGC
+TATTGTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGACGACTTACTAGTAGAGGTGAAAAGCCAATC
+GAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAACTA
+ATAGAACCCTAATGAAGCGAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATC
+TCTACGAGCGGATAAATAATCTATAGAAAGATTTCCTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGC
+GTTAAAGCTCTTCGACTAAAAAATATAAGAACTTCATGACTCCCTCATCATTAACAGGCTAACCTATATG
+TAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGGTCCTCCCTCTACGACGCAAGCTTACATCTTTAC
+ATTATTAACAAATCACCAAGATACGACAAATCAAACAAGCAGAGTATCAGGTAAATTGTTAACCCGACAG
+AGGAGCGTCCATTAAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACATCAAGGCCCGACTGTTT
+ACCAAAAACATAGCCTTCAGCAAACAGCAAACAAGTATTGAAGGTGATGCCTGCCCTGTGACTTAGTGTT
+TAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGGGACCAGTATGA
+ATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGG
+GATAACTACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACCCCTACACACATTCACTC
+CCACTGGGTACACGCTCATACAGGGAACTGGCCTGCATTTTTCGGTTGGGGCGACCTTGGAGAAAAACAA
+ATCCTCCAAAAATTAGACCACAACTCTAGACTGAGAGCGACCCCTCAACGTGCGAATAGCACCCAGACCC
+AATATAATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGA
+CGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTT
+GTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCCATCTATGA
+TGAACTCTTCCCAGTACGAAAGGACAGGAAAAGTGAGGCCAATACTACAAGCAAGCCTTCGCCTTAAGTG
+ATGAATCCAACTAAATTACGAAAGGCTATCACACTACAACCATGTCCTAGAAAAGGACTAGCTAGCGTGG
+CAGAGCTCGGAAAATGCAAAAGGCTTAAGTCCTTTATATCAGAGGTTCAAATCCTCTCCCTAGCTAAACT
+TAAAATGGCCAACTATCCCATCCTAGTCAACCTCATTATAGCACTTTCTTATGCCATCCCCATTCTAATT
+GCCGTAGCCTTTTTAACCCTAGTAGAACGTAAAATCCTAAGTTACATACAAGGCCGAAAAGGGCCCAACG
+TTGTAGGCCCTTTCGGGCTCCTGCAGCCAGTAGCAGATGGGGTAAAGCTATTCATCAAAGAACCAATCCG
+CCCATCAACATCCTCCCCAATTCTATTTATTACCACCCCAATACTAGCCCTCCTACTAGCAATCTCCATC
+TGAACCCCACTTCCAATCCCATTCCCACTTGCAGATCTAAACCTAGGACTGCTATTCATATTAGCCATGT
+CAAGCCTAGCAGTATACTCAATCCTATGATCTGGCTGAGCCTCCAACTCAAAATACGCCCTAATCGGATC
+TCTACGGGCAGTAGCCCAGACAATTTCATACGAGGTCACCCTAGCAATCATCCTACTATCCATCATCCTT
+CTCAGTGGAAATTATACTCTAAGCACCCTAGCAGTTGTTCAAGAGCCCCTATTTCTTATCTTCTCCTGCT
+GACCCCTCGCCATAATATGATATGTATCTACACTGGCCGAAACAAATCGTGCCCCATTCGACCTCACAGA
+AGGGGAATCAGAACTAGTCTCAGGATTCAACGTAGAATATGCCGCAGGGCCCTTCGCTTTATTCTTCCTA
+GCAGAATACGCGAACATCATGCTCATAAACGCACTAACCGTAATCCTGTTCTTCAACCCAAGCCTATACA
+ATCCACCTCAAGAACTCTTCCCCGTAATTCTAGCCACAAAAGTCCTACTCCTGTCCATAGGATTCCTATG
+AATTCGTGCCTCCTACCCACGATTCCGATATGATCAGCTAATGCATTTACTATGAAAAAACTTCCTCCCA
+CTAACGCTCGCTCTATGTCTGTGACACATTAGCATACCAATTTCCTACGCAGGCCTACCTCCTTACCTAA
+GGAGCCACCAGGAAATGTGCCTGAACGTCAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAG
+CCCTCTCATTTCCTACACCTTAGAAAAACAGGAATCGAACCTGTACAAGAGAGATCAAAACCCTCCATAC
+TTCCTTTATATTATTTTCTAGTAGGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTT
+TAACCCCTTCCCCTGCTAATGAACCCCCAGGCAAAACTGATTTTTATCACTAGCCTACTCCTAGGAACAA
+CCATCACAATTTCAAGCAACCATTGAGTCATGGCCTGAACCGGCCTTGAAATCAACACACTCGCTATTCT
+GCCCCTAATTTCAAAATCCCACCATCCCCGAGCTATTGAGGCAGCAACCAAATATTTTCTAGTTCAAGCA
+ACTGCCTCAACTCTGGTACTATTCTCCAGCATAACCAATGCATGGTACACTGGGCAATGAGATATCACCC
+AGCTAACCCACCCAGCATCCTCCCTAATCCTAACCGCAGCTATTTCAATGAAGCTTGGACTAGTACCCTT
+TCACTTCTGATTCCCAGAAGTCCTACAAGGCTCCCCCCTCATTACTGGCCTTCTCCTGTCCACAGCCATG
+AAATTTCCACCAATTACCCTACTCTACATAACCTCCCTATCCCTAAACCCCACACTACTAACCACCCTGG
+CCGTTCTTTCTGTAGCCATAGGAGGCTGAATAGGACTAAACCAAACACAAGTCCGAAAAATTATGGCCTT
+CTCCTCTATCTCACACCTAGGCTGAATGGCCATTATCTTAATCTACTACCCCAAACTTACTCTACTCAAC
+TTCTACCTGTATGCCATAATAACCGCTGCCGTATTCCTAACCCTAAACTCAATAAAAGTCCTAAACCTAT
+CCACACTAATAACTGCATGAACAAAAGCACCTGCACTTAGCACAATCCTCCTACTAACACTTCTGTCCCT
+GGCCGGCCTCCCCCCTTTAACCGGCTTCCTCCCAAAATGACTCATTATTCAAGAACTAACCAAACAGGAC
+ATAGCTCCGGCAGCAATTATTATCTCCCTTCTTTCACTACTGGGTCTCTTCTTCTACCTCCGTCTTGCGT
+ATTGTGCAACAATCACACTTCCGCCCCACACAACAAACCACATGAAACAATGACGTACCAACAAACCAGT
+TAGCCCCTCAATTGCCATTTTAACAACCCTATCCATCATGCTCCTCCCAACTTCCCCCATACTCACTACC
+ATTATTTAAAGAGAAACTTAGGTTTACTGAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCT
+CTTAGTTTCTGTTAAAATCCGCAGGACGTTATCCTGCATCTTCTGAATGCAACTCAGATGCTTTAATTAA
+GCTAGGATTTTGCACCTCTAGACAGATGGGCTTCGATCCCATGATACTATAGTTAACAGCTATATGCCCT
+AAACCAACAGGCTTCTGCCTAACAGACTCCGGTGCACTGTCAGTGCACATCGATGAGCTTGCAACTCACC
+ATGAACTTCACTACAGAGCCGATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT
+ATACACTCAGCCATCTTACCCGTGACTTTCATCAACCGATGACTATTCTCAACCAACCACAAAGACATTG
+GCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATTCGAGC
+AGAACTGGGCCAACCAGGTGCTCTACTAGGAGATGACCAAATCTACAATGTAATCGTCACAGCTCATGCC
+TTTGTCATAATTTTCTTCATAGTTATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTTCCACTAA
+TGATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCACCCTCATT
+CCTCCTACTTCTAGCTTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTG
+GCTGGTAACATAGCCCATGCTGGAGCCTCAGTTGACCTTGCAATCTTCTCACTACACCTAGCAGGTATTT
+CTTCCATCCTAGGAGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATA
+TCAAACCCCCCTATTCGTATGATCCGTACTAATTACCGCAGTACTGCTCCTTCTCTCCCTACCCGTACTT
+GCTGCCGGAATTACTATGCTTCTAACAGACCGTAACCTCAATACCACATTCTTCGACCCAGCAGGAGGAG
+GAGACCCGGTACTATACCAGCACCTGTTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTACC
+AGGATTTGGTATTATTTCTCACGTCGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGA
+ATAGTATGAGCCATGCTATCCATCGGGTTCTTAGGCTTCATCGTTTGAGCACACCACATGTTTACAGTCG
+GAATGGACGTAGACACTCGAGCATACTTCACATCCGCCACCATAATCATTGCCATCCCAACCGGAATCAA
+AGTGTTCAGCTGACTGGCAACTCTTCACGGAGGAACAATCAAATGAGATCCACCAATGCTGTGAGCCCTA
+GGATTCATCTTCCTCTTCACTATTGGTGGACTAACAGGAATTGTCCTAGCAAACTCCTCCCTAGACATTG
+CCCTACACGACACTTACTACGTAGTAGCTCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAAT
+CCTAGCAGGATTTACCCACTGATTCCCACTATTCACCGGATACACCCTACACTCTACATGAGCTAAAATC
+CACTTCGGGGTGATATTCGTAGGAGTAAACCTTACTTTCTTCCCACAACACTTCCTTGGACTAGCTGGCA
+TGCCACGACGATACTCAGACTACCCAGACGCCTACACTCTATGAAACACTATCTCATCAGTAGGATCACT
+AATTTCCCTAACCGCCGTAATCATGCTGATATTTATCATCTGAGAAGCTTTCGCATCCAAACGTAAAGCC
+CTACAGCCAGAACTAGTCAATACAAACGTCGAATGAATCCACGGCTGCCCACCACCATTCCACACATTCG
+AAGAACCAGCCTTCGTTCAAGTTCAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACC
+GCATAAACCACTTATGCTTCTTTCTCATTTAGAGGTGTTAGTAAAACTATTACATAGTCTTGTCAAGACT
+AAATTACAGGTTAAAGCCCAGTACACCTCAACACAAATATGGCCAACCACATACAATTCGGTTTTCAAGA
+CGCTTCATCCCCTATCATAGAAGAACTAGTAGAATTTCACGACCACGCTCTAATAACTGCCCTAGCTATT
+TGCAGCCTGGTACTATACCTACTAACCATGATACTCACCGAAAAGCTATCATCCAGCACAGTCGATGCAC
+AAGAAATCGAACTTGTCTGAACAATCCTCCCTGCAATTGTCCTAATCATGCTTGCTCTACCATCCCTACA
+AATCCTCTACATAATGGATGAAATTAACGAGCCCGACCTGACACTAAAAGCCATTGGACACCAATGATAC
+TGATCTTACGAATACACCGACTTCAAGGACCTAACATTTGACTCTTACATGACACCAACTGCAGACCTAC
+CGTTAGGTCACTTCCGACTACTAGAAGTGGACCATCGTGTAGTTGTCCCAATGGAATCACTAGTTCGAGT
+CATCGTTACTGCCGACGACGTACTTCACTCATGAGCCGTCCCAAGCCTAGGCGTAAAAACTGACGCAATC
+CCAGGACGACTGAACCAAACCTCATTCACCGCCACTCGACCTGGAGTATTCTACGGTCAATGCTCAGAAA
+TTTGTGGGGCTAATCACAGCTTCATACCAATTGTAGTTGAATCTGCTCCACTCGCCAATTTCGAGAACTG
+ATCCTCTCTACTATCATCTTAATCATTAAGAAGCTATGAACCAGCGCTAGCCTTTTAAGCTAGAGAAAGA
+GGACTATTCATCCTCCTTAATGATATGCCTCAACTAAACCCAAACCCATGATTTTTTATCATGCTAGCTT
+CGTGACTCACCTACTCCATAATCATCCAACCTAAACTACTATCCTTTGTCTTCATAAACCCTCCAATCAG
+CAAAACCCAAACAACCCCAACCACCTCCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCT
+CAAGCCCATCCCTACTAGGTATTCCCCTAATCCTGATCGCAATAACATTCCCTGCCCTCCTGCTGTCAAC
+CCAAAACAACCGATGAATCACTGATCGCCTATCCACTTTACAATCATGATTCATCAGCCTAATTACAAAA
+CAGCTGATAATGCCACTAAGCAACAAGGGACATAAATGAGCCCTAATCCTAACATCGCTAATACTATTTC
+TCCTACTTATCAACCTGCTAGGCCTACTACCCTACACATTCACCCCAACAACCCAACTTTCTATAAACCT
+AGCTCTAGCAATTCCCCTATGACTTGCCACCCTGCTCACAGGACTACGAAACCAACCCTCAATCTCCCTA
+GCCCACCTCCTACCAGAAGGAACCCCAACTCCACTAATCCCAGCCCTAGTCCTCATTGAAACAACTAGCC
+TTCTTATTCGTCCCCTAGCCCTAGGCGTTCGCCTTACAGCCAACCTCACAGCAGGCCATCTATTAATCCA
+ACTTATCTCAACAGCCACTGCCTCCCTAGTCTCAACAATACCAATAATCTCACTACTAACATTATTAGTA
+TTATTCCTACTCACAGTCCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTATTTGTGCTACTACTAA
+GCCTGTATCTACAAGAAAACATTTAAACCACCAATGACTCACCAAGCACACTCTTATCACATAGTTGACC
+CAAGCCCATGACCCATCCTAGGAGCAGCCGCTGCTCTTCTTACTACATCCGGCCTAACCGTATGATTCCA
+CTACAACTCGCCATACCTACTGATCATAGGACTAACTTCTACTGCCCTGGTTATACTTCAATGATGACGT
+GACATCATCCGAGAAAGTACATTCCAAGGCCACCACACACCCACAGTACAAAAAGGCCTACGATATGGAA
+TAGTCCTATTCATCACATCAGAGGCCTTCTTCTTCCTAGGTTTCTTTTGAGCATTCTTCCACTCCAGCCT
+GGCCCCAACACCAGAGCTAGGAGGACAGTGACCTCCAGTCGGAATCAAACCTCTAAACCCAATGGACGTC
+CCCCTCCTAAACACCGCCATCCTACTTGCTTCAGGAGTCACAGTCACATGAGCACACCATAGCATCATAG
+AAGCTAACCGAAAACAAGCAATCCACGCCCTCACCCTTACAGTTCTCCTAGGCTTCTACTTCACCGGCCT
+GCAAGCCATAGAATACTACGAAGCTCCGTTCTCCATCGCTGACGGGGTATACGGTTCTACCTTCTTCGTA
+GCAACTGGCTTCCACGGCCTCCACGTAATCATTGGTTCCACATTCCTCCTAGTATGCCTTCTACGCCTAA
+TCAAATACCACTTTACACCAAAACACCATTTTGGCTTCGAAGCAGCAGCTTGATACTGACACTTTGTAGA
+CGTCGTATGACTATTCCTCTATATGACTATCTACTGATGAGGATCCTACTCTTCTAGTATATTAATTACA
+ATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATGAACATAATCCTATTCATAATA
+GTCTCATCTTTAACTCTAAGTGTCATCCTCACTGCATTAAACTTTTGACTAGCACAAATAAACCCAGACT
+CAGAGAAACTGTCCCCATACGAATGTGGATTTGACCCACTAGGGTCCGCCCGGCTGCCATTTTCAATTCG
+ATTTTTCCTAGTTGCAATCTTATTTTTACTATTTGACCTAGAAATTGCTCTGCTCCTTCCACTACCATGA
+GCCATCCAGCTACAAACCCCCACCCTTACACTAACATGGGCCTCCATCCTTATTCTTCTCCTTACTCTAG
+GTCTGGTTTATGAATGAAGCCAAGGAGGACTAGAATGAGCAGAATAACAGAAAGTTAGTCTAACCAAGAC
+AGTTGACTTCGACTCAACAGATTATAGCTAACGCCCTATAACTTTCTTAATGTCTGCCCTACAATTAAGC
+TTTTTTTCCGCCTTCACCCTAAGCGGCCTAGGCCTAGCCTTCCACCGCACACACTTAATCTCCGCCCTAC
+TATGTCTAGAAAGTATGATACTATCCATATACGTCGCCCTTTCCATGTGACCAATCCAGACCCAAACAAC
+ATCTGCTACCCTCCTACCACTTCTCATACTAGCATTCTCTGCTTGTGAGGCAGCAACAGGCCTAGCTCTA
+CTAGTCGCCTCCACCCGGACCCACGGCTCCGACCACCTGCACAACTTTAACCTACTACAATGCTAAAAAT
+CATTATTCCAACCATCATACTCCTACCACTGACCTTCCTCTCCCCCTACAAACACCTATGAACTAACACC
+ACAACACACAGCCTATTAATTGCCGCTGTCAGCCTCCAATGACTAGTCCCAACATACTACCCAAGCAAAG
+GACTAACCCATTGAACCTCAATTGACCAAATCTCCTCCCCCCTACTAGTTCTATCGTGCTGACTACTCCC
+ACTCATACTCATAGCAAGCCAAAACCACCTAGAACAAGAGCCAATCATCCGTAAACGAATCTTCATCACA
+ACTATAATCACAGTACAGCCCTTTATCCTGCTGGCTTTCTCAGCTTCAGAACTAATACTATTCTACATCG
+CATTTGAAGCAACCCTAATTCCAACCCTAATCCTTATCACACGATGAGGAAACCAACCCGAACGACTGAA
+CGCAGGCATTTACCTGCTATTTTATACACTCGCCAGCTCTCTTCCTCTGCTGATCACAATCCTCCACCTA
+CATAACCAAATTGGCACATTATACCTCCCTATACTCAAACTATCGCACCCAACAATAAACAACTCTTGAA
+CAGGCCTACTAGCAAGCTTAGCCCTCCTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGTCTTCATCT
+ATGACTCCCAAAAGCACATGTAGAAGCCCCAATCGCCGGATCCATGCTACTAGCCGCTCTCCTCCTAAAA
+CTTGGCGGCTACGGCATTATACGAATCACTATCCTAGTAAACCCCTCTGTAAACAACCTACACTACCCAT
+TCATTACTTTAGCACTATGAGGAGCAGTAATAACCAGTGCCATCTGCCTACGACAAATCGACCTAAAGTC
+CCTAATTGCTTACTCCTCTGTAAGCCATATAGGACTAGTCATCGCCGCAACCATAATTCAAACCCAATGA
+GCCTTCTCAGGGGCAATAATCCTAATAATCTCTCACGGCCTAACCTCCTCTATACTATTCTGCCTGGCCA
+ATACAAACTACGAACGAACTCACAGCCGAATCCTACTTCTAACCCGAGGACTTCAACCCCTCCTACCACT
+TATGGCCACCTGATGACTACTAGCAAACCTAACAAACATGGCACTACCACCAACAACCAACCTCATAGCA
+GAACTAACCATTGTAGTAGCCCTGTTCAACTGATCCCCACTGACAATCATTTTAACAGGAACTACAATCG
+TACTAACTGCCTCTTATACCCTACATATGCTAATAACAACACAACGAGGAATACTACCATCCCACATCAC
+CTCAATCCAAAATTCCTCAACACGAGAACATCTCCTGATGGCCCTACACATAATTCCCATAATCCTACTT
+ATTCTCAAACCTGAACTAATCTCAGGAATCCCTATATGCAAGTATAGTTTAATCAAAACATTAGATTGTG
+ATTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGGAGGTTAAACCAACAAGAACTGCTAATTC
+TTGCATCTGAGTATAAAACCTCAGCCCCCTTACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAAC
+CAGTCATCTTGGTGCAAATCCAAGTGAAAGTAATGGACCAAATACTTATCCTAAACACATTCATACTACT
+CACCCTAGCAGTACTCTGCACCCCAATCATCTTCCCCATACTATCAAGCAGCCTAAAAAACACTCCAACT
+ATCATTACAAACACTGTCAAAACTTCCTTCCTAATCAGCCTGATCCCCATAACCATCTACATTCACTCAG
+GAATAGAAAGTCTAACTTCCTTCTGGGAATGAAAATTCATTATAAACTTTAAAATTCCTATCAGCCTAAC
+AATAGACTTCTACTCACTGACTTTCTTCCCAATTGCCCTATTTGTCTCCTGATCAATCCTACAATTTGCA
+ACATGATACATAGCCTCAGACCCGCACGTCGCAAAATTTTTCACCTTCCTCCTCCTATTCCTTATTGCCA
+TGCTCATCCTGATTATCTCCAACAACCTGTTCCTACTCTTCATCGGATGAGAAGGAGTAGGAATCATATC
+CTTCCTACTAATCAGCTGATGACATGGCCGAGCAGAAGCAAATACCGCTGCCCTACAGGCCGTACTATAC
+AACCGAGTCGGAGATGTAGGCCTTATCCTGTGCATGGCATGACTAGCTTCCACCATAAACACATGAGAAA
+TTCAACAAATCTCATCTCAGGACCAAACTCCTACCCTACCACTACTAGGCTTAATTTTAGCTGCGGCCGG
+CAAATCCGCCCAATTTGGCCTCCACCCGTGACTCCCAGCAGCAATAGAAGGCCCAACCCCTGTATCCGCC
+TTACTTCATTCCAGCACCATAGTAGTCGCCGGGATCTTCCTACTTATCCGAACTCACCCCCTCTTCCACA
+ACAACCCCACTGCACTATCACTATGCCTATGCCTGGGAGCCCTCTCCACACTATTCGCAGCCACTTGCGC
+CCTGACCCAAAATGATATCAAAAAAATCATTGCTTTTTCCACATCCAGCCAACTAGGCCTAATAATAGTT
+ACAATCGGCCTAAATCTTCCCCATCTAGCCTTCCTGCATATTTCAACCCACGCATTCTTCAAAGCCATGC
+TATTCCTATGTTCAGGGTCAATCATTCACAGCCTCAACGGCGAACAAGACATTCGAAAAATAGGAGGACT
+TCAAAAAATACTACCAACAACAACCTCATGCCTAACTATCGGAAACCTAGCCCTGATAGGAACACCATTT
+CTGGCAGGATTCTACTCCAAAGACCAAATTATCGAAAGCCTCAACACCTCGTACTTAAACGCTTGAGCCC
+TAGTTCTAACTCTCCTAGCTACATCATTCACCGCAGTATATACTATTCGAATAACCCTATTAGTTCAAAC
+AGGATACGTCCGAATTCCTCCCCTAACCCCCATGAACGAAAATAACCCAGCAGTCCTCTCCTCAATCACT
+CGACTTGCACTAGGAAGCATTGTAGCAGGATTCCTAATCACCTCATATATTCCACCTGCAAAAACCCCAC
+CAATAACTATACCACTATCCATTAAAGTCACGGCCCTTGTAGTAACACTACTAGGAATCATCCTAGCCCT
+AGAACTCTCAAAACTAACTCAAGCTTTAATCCTCCCTAAACAGAATCGCTTCTCAAATTTCTCTACAGCC
+CTAGGATACTTTAATCCCCTAGTACACCGATTTATCCCAACAAAAATACTAAGCGGCGGCCAAAACATTG
+CCTCCCACCTAATTGACCTCTCTTGATTCAAACTTCTAGGCCCTGAAGGGTTAGCCAACCTACAAATAAT
+AGCATCAAAAACCGCTACCTCCTTCCACACAGGCCTAATTAAAGCCTACCTAGGATCATTTGCCTTATCA
+ATCTTTATCATCCTCCTATCCACATACAGAACCAAACTTAATGGCCCTAAATCTACGAAAAAATCACCCA
+CTACTAAAAATCATCAACAACTCCCTAGTTGACCTTCCCACTCCATCAAACATTTCAGCTTGATGAAACT
+TCGGATCCCTACTAGGCCTATGCCTCATCACACAAATTGTCACAGGCCTACTACTAGCCATACATTACAC
+AGCAGACACCTCCCTAGCCTTCGCTTCCGTAGCCCACATATGCCGAGACGTACAATTCGGATGACTAATC
+CGAAACCTCCACGCAAATGGGGCCTCCTTCTTTTTCATTTGCATCTACCTACATATTGGCCGAGGATTCT
+ATTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTAGTCCTTCTTCTAACACTAATAGCAAC
+TGCCTTCGTAGGATACGTCCTGCCATGAGGACAAATATCTTTCTGAGGAGCTACAGTCATTACAAACCTT
+TTCTCAGCAATCCCATACATTGGACAAACATTAGTAGAATGACTATGAGGCGGGTTCTCAGTAGACAACC
+CCACACTAACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTGTAATCGCAGGCCTGACACTAGTACA
+CTTAACCTTCCTCCACGAAACAGGCTCAAACAACCCACTAGGAATCCCCTCAGATTGCGACAAAATTCCA
+TTCCACCCTTACTACTCCATCAAAGACCTACTAGGATTCGCACTAATACTCGTCCCATTCGTCACTCTGG
+CCCTATTTTCCCCAAACCTCCTAGGAGACCCAGAAAATTTCACGCCCGCCAACCCCCTGGCCACACCTCC
+CCACATTAAACCCGAATGATACTTCCTATTTGCATACGCCATTCTCCGATCCATCCCAAACAAACTAGGA
+GGAGTCCTAGCTCTAGCCGCCTCAGTCCTAGTCCTATTCCTAATACCTCTCCTCCACACGTCTAAACAAC
+GTTCCATAACCTTTCGACCCCTATCACAAATCCTATTCTGAGCTCTAGTCGCAGACCTCTTCATCCTAAC
+ATGAGTAGGAAGCCAACCAGTCGAACACCCATTCATCATCATTGGCCAACTAGCCTCCTTCACCTACTTC
+GCAATCATCCTAATCCTGTTCCCTATCGCGAGTGCACTAGAAAACAAAATACTAAAACTCTAATCAACTC
+TAATAGTTTATAAAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACATCTTCTTAGAGTTAACAC
+ATAAATCAGAAAGAAAGGAGTCAAACCTTTATCACCAACTCCCAAAGCTGGCATTCTCAATTAAACTACT
+CTCTGACCTACCAATTAAACCGCCCGAATTGCCCCCCGAGATAACCCCCGCACAAGTTCTAAAACCACAA
+ACAGTGTTAATAACAGGCCTCATCCTGCAATTAAAAGCAGCCCTGACCCAGACGAATAGAACATAGCTAC
+TCCACTAAAATCCGTCCGAGTTCACGATAGACCTCCATTATTCACCGTATCCCCTCCCATAATCACTTCA
+GAAAACACCCCTGTAGCAAACCCCACAATAACAACGACTAACCCCAGACCAACACCATAACCAACAACCC
+GTCAATCACCCCAAGATTCCGGATAAGGATCCGCTGCCAGAGACACTGAATAAACAAATACCACCAGCAT
+CCCCCCTAAATATACCATCACCAGTACAAGAGAAACAAAAGAAACCCCCATACTTACCAGTCACCCACAT
+CCAGCAATAGAAGCCACAACCAGACCCACCACCCCATAATAAGGAGAAGGGTTAGACGCAACCGCTAACC
+CTCCTAAAACAAAGCATAGACTCATAAAAAGAACAAAGTTTATCATAGTTCCTGCTTGGATCCTCCCCAA
+GACCTATGGCTTGAAAAACCATTATTATAAAACTTTAACTACAGGAACTAAACCCTACTCTCATCCACCC
+CCCCCCCTTACCCCCCCCATGTTTTTACATGGGATTTTGGCTATGTATTTCTTTGCATACAATTCTCGTC
+CACATTAGACATAATATGCATGTAGGATAACTCACATAACAAGTAATGCAAGACCTAACCAAACTCAAAT
+ATCATCGCCCATAACACCCCAAACGGACAGATAACCTTCCAGGCACATCCCCATCGCAGGCACAACAAAC
+CCAGGTAATCCTACCAACGACACAAGACAAGCTTCGCCCAAGATCGAGAATGTTTTACCTTACATAACAA
+CGCACTCTCGTAAACGAGGAATATCCTAGTACCCCAATGAATTCTTAATCCCATACGTTTCAGTCCATCA
+CCACAAAACCTCCTAGTCCTATCACTCTCAAGAGCTCCCAAGAAGGACCTGGTTATTTATTAGTCGTAAT
+CCTCACGAGAACCGAGCTACTCAACGTAGGTGCTACCCACGGCTACCAGCTTCAAGGCCATACTTTCCCC
+CTACACCCTCGCCCAACTTGCGCTTTTGCGCCTCTGGTTCCTATTTCAGGGCCATAACTTGGACCTTTCC
+CTCCTTATCGCTCTTCACAGATGCAAGTGGTCGGATGCATAATCCTCCCTTTGCCTCGTGATCGCGGCAT
+CCGACCGACTTGGCGCTTGTTTTCTTTTTGGGGTCTCTTCATTAAACCCTTCAAGTGCGTAGCAGGAGTT
+ATCTTCCTCTTGACGTGTACATCACATGGCATCCGAGCGGCTATTTGTCTGTAATGTACCTGGTGTCATG
+GTTGTTCGGATAAGGTCGTCTCAAACTTGACACTGATGCACTTTTACCCCATTCATGGTGGGTCCCCCAG
+CTACCTATACGGTGGCAGATAATGTTATGGTTGCCGGACATAGTTTGTTATTTTTCCTTTACTAGGAATT
+ATCACCCAAACCTTCATTTTCATTCTTTTTTTTATCGTTTATTTTTATGTTGTAATTTTAACAAAATAAA
+CAACAACTTTTATATGATATTAACCTAGATTTTCCAAACCATTCATCGTTCGTTCATTAACACTTAACTT
+TCCTCTGCCTTTCCCCTATTTTTAACCCAACAAATCAATGACTTTCATCATAACTTCCACAACCACCAAC
+TTAGCCAAATTACACAAAACAAACAAACCAATTAAAAACAAGATAAAAGTACACACCCTTTACACACAAC
+CACACTAAACACACAACAAAACTTAACACACTATATGCCACAATACTACTTTTCATTTATAAAAAAAACA
+AGATAAAAATACAAAACATCAATACCAATAATAAGTCCAAAATACTACATTCGCTT
diff --git a/dat/csf.txt b/dat/csf.txt
new file mode 100644
index 0000000..0fd2e61
--- /dev/null
+++ b/dat/csf.txt
@@ -0,0 +1,243 @@
+>gi|669032233|ref|NC_024607.1| Corvus splendens mitochondrion, complete genome
+GTCCATGTAGCTTACAATAAAGCATGACACTGAAGATGTCAAGACGGCTGCCACAAACACCCATGGACAA
+AAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCCAGAATTATACATGCAAGTATCCGCATTCCAGTGTA
+AATGCCCTAGGCACCCTTTAACCAAGTCGATAGGAGCGGGTATCAGGCACACACAATTGTAGCCCAAGAC
+GCCTTGCACTTGCCACACCCCCACGGGTATTCAGCAGTGGTTAACATTAAGCAATGAGTGTAAACTTGAC
+TTAGTCATGGCAACCTTAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACTCAAATT
+AACAGTATAACGGCGTAAAGGGTGGTAACATGCTATCTAAGTAACTAAGATTAAAAAGCAACTGAGCTGT
+AATAAGCCCAAGATGCTCATAAGGCCAACTACCAAAGAAGATCTTAGACTGACGATTAATTGAAATCCAC
+GAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCTCTATGCTA
+CCTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACC
+CACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCACTCCTTGCTGAATCAGCCT
+ACATACCGCCGTCGCCAGCCCACCCCCCCTGATGGTTCAACAGTGAGCGCAATAGTCCCTACCCACTAGT
+AAGACAGGTCAAGGTATAGCCCATGGAGTGGAAGTAATGGGCTACATTTTCTAGTTTAGAACATCACGGC
+AAAAGGGTCTGAAATGGCCCTTAGAAGGCGGATTTAGCAGTAAAGTGGGACAATCGAGCCCTCTTTAAGC
+CGGCTCTGGGATGCGTACATACCGCCCGTCACCCTCCTCACAAGCGACCCAAACCCCCCAATACATTAAT
+ACGCTATCCAGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACAACCA
+AGACGTAGCTTAGACGAAAGCATTCAGCTTACACCTGAAAAACATCTGCTAACACCAGATCGTCTTGATG
+CCAAATTCTAGCCCAACCACATTGACCTGGAATAACAAAGCTACTACATACACCAAACTAAAGCATTCAC
+TAGTCTTAGTATAGGCGATAGAAAAGACACCAATTGGAGCGATAGAGATCACGTACCGTAAGGGAAAGAT
+GAAATAATAATGAAAAAACTAAGCTATAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTA
+GCAAGAAAAACCAAGCAAAATGAGTTTAAGTTTGCCACCCCGAAACCTAAGCGAGCTACTTGTGAGCAGC
+TATTGTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGACGACTTACTAGTAGAGGTGAAAAGCCAATC
+GAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAACTA
+ATAGAACCCTAATGAAGCGAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATC
+TCTACGAGCGGATAAATAATCTATAGAAAGATTTCCTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGC
+GTTAAAGCTCTTCGACTAAAAAATATAAGAACTTCATGACTCCCTCATCATTAACAGGCTAACCTATATG
+TAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGGTCCTCCCTCTACGACGCAAGCTTACATCTTTAC
+ATTATTAACAAATCACCAAGATACGACAAATCAAACAAGCAGAGTATCAGGTAAATTGTTAACCCGACAG
+AGGAGCGTCCATTAAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACATCAAGGCCCGACTGTTT
+ACCAAAAACATAGCCTTCAGCAAACAGCAAACAAGTATTGAAGGTGATGCCTGCCCTGTGACTTAGTGTT
+TAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGGGACCAGTATGA
+ATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGG
+GATAACTACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACCCCTACACACATTCACTC
+CCACTGGGTACACGCTCATACAGGGAACTGGCCTGCATTTTTCGGTTGGGGCGACCTTGGAGAAAAACAA
+ATCCTCCAAAAATTAGACCACAACTCTAGACTGAGAGCGACCCCTCAACGTGCGAATAGCACCCAGACCC
+AATATAATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGA
+CGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTT
+GTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCCATCTATGA
+TGAACTCTTCCCAGTACGAAAGGACAGGAAAAGTGAGGCCAATACTACAAGCAAGCCTTCGCCTTAAGTG
+ATGAATCCAACTAAATTACGAAAGGCTATCACACTACAACCATGTCCTAGAAAAGGACTAGCTAGCGTGG
+CAGAGCTCGGAAAATGCAAAAGGCTTAAGTCCTTTATATCAGAGGTTCAAATCCTCTCCCTAGCTAAACT
+TAAAATGGCCAACTATCCCATCCTAGTCAACCTCATTATAGCACTTTCTTATGCCATCCCCATTCTAATT
+GCCGTAGCCTTTTTAACCCTAGTAGAACGTAAAATCCTAAGTTACATACAAGGCCGAAAAGGGCCCAACG
+TTGTAGGCCCTTTCGGGCTCCTGCAGCCAGTAGCAGATGGGGTAAAGCTATTCATCAAAGAACCAATCCG
+CCCATCAACATCCTCCCCAATTCTATTTATTACCACCCCAATACTAGCCCTCCTACTAGCAATCTCCATC
+TGAACCCCACTTCCAATCCCATTCCCACTTGCAGATCTAAACCTAGGACTGCTATTCATATTAGCCATGT
+CAAGCCTAGCAGTATACTCAATCCTATGATCTGGCTGAGCCTCCAACTCAAAATACGCCCTAATCGGATC
+TCTACGGGCAGTAGCCCAGACAATTTCATACGAGGTCACCCTAGCAATCATCCTACTATCCATCATCCTT
+CTCAGTGGAAATTATACTCTAAGCACCCTAGCAGTTGTTCAAGAGCCCCTATTTCTTATCTTCTCCTGCT
+GACCCCTCGCCATAATATGATATGTATCTACACTGGCCGAAACAAATCGTGCCCCATTCGACCTCACAGA
+AGGGGAATCAGAACTAGTCTCAGGATTCAACGTAGAATATGCCGCAGGGCCCTTCGCTTTATTCTTCCTA
+GCAGAATACGCGAACATCATGCTCATAAACGCACTAACCGTAATCCTGTTCTTCAACCCAAGCCTATACA
+ATCCACCTCAAGAACTCTTCCCCGTAATTCTAGCCACAAAAGTCCTACTCCTGTCCATAGGATTCCTATG
+AATTCGTGCCTCCTACCCACGATTCCGATATGATCAGCTAATGCATTTACTATGAAAAAACTTCCTCCCA
+CTAACGCTCGCTCTATGTCTGTGACACATTAGCATACCAATTTCCTACGCAGGCCTACCTCCTTACCTAA
+GGAGCCACCAGGAAATGTGCCTGAACGTCAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAG
+CCCTCTCATTTCCTACACCTTAGAAAAACAGGAATCGAACCTGTACAAGAGAGATCAAAACCCTCCATAC
+TTCCTTTATATTATTTTCTAGTAGGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTT
+TAACCCCTTCCCCTGCTAATGAACCCCCAGGCAAAACTGATTTTTATCACTAGCCTACTCCTAGGAACAA
+CCATCACAATTTCAAGCAACCATTGAGTCATGGCCTGAACCGGCCTTGAAATCAACACACTCGCTATTCT
+GCCCCTAATTTCAAAATCCCACCATCCCCGAGCTATTGAGGCAGCAACCAAATATTTTCTAGTTCAAGCA
+ACTGCCTCAACTCTGGTACTATTCTCCAGCATAACCAATGCATGGTACACTGGGCAATGAGATATCACCC
+AGCTAACCCACCCAGCATCCTCCCTAATCCTAACCGCAGCTATTTCAATGAAGCTTGGACTAGTACCCTT
+TCACTTCTGATTCCCAGAAGTCCTACAAGGCTCCCCCCTCATTACTGGCCTTCTCCTGTCCACAGCCATG
+AAATTTCCACCAATTACCCTACTCTACATAACCTCCCTATCCCTAAACCCCACACTACTAACCACCCTGG
+CCGTTCTTTCTGTAGCCATAGGAGGCTGAATAGGACTAAACCAAACACAAGTCCGAAAAATTATGGCCTT
+CTCCTCTATCTCACACCTAGGCTGAATGGCCATTATCTTAATCTACTACCCCAAACTTACTCTACTCAAC
+TTCTACCTGTATGCCATAATAACCGCTGCCGTATTCCTAACCCTAAACTCAATAAAAGTCCTAAACCTAT
+CCACACTAATAACTGCATGAACAAAAGCACCTGCACTTAGCACAATCCTCCTACTAACACTTCTGTCCCT
+GGCCGGCCTCCCCCCTTTAACCGGCTTCCTCCCAAAATGACTCATTATTCAAGAACTAACCAAACAGGAC
+ATAGCTCCGGCAGCAATTATTATCTCCCTTCTTTCACTACTGGGTCTCTTCTTCTACCTCCGTCTTGCGT
+ATTGTGCAACAATCACACTTCCGCCCCACACAACAAACCACATGAAACAATGACGTACCAACAAACCAGT
+TAGCCCCTCAATTGCCATTTTAACAACCCTATCCATCATGCTCCTCCCAACTTCCCCCATACTCACTACC
+ATTATTTAAAGAGAAACTTAGGTTTACTGAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCT
+CTTAGTTTCTGTTAAAATCCGCAGGACGTTATCCTGCATCTTCTGAATGCAACTCAGATGCTTTAATTAA
+GCTAGGATTTTGCACCTCTAGACAGATGGGCTTCGATCCCATGATACTATAGTTAACAGCTATATGCCCT
+AAACCAACAGGCTTCTGCCTAACAGACTCCGGTGCACTGTCAGTGCACATCGATGAGCTTGCAACTCACC
+ATGAACTTCACTACAGAGCCGATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT
+ATACACTCAGCCATCTTACCCGTGACTTTCATCAACCGATGACTATTCTCAACCAACCACAAAGACATTG
+GCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATTCGAGC
+AGAACTGGGCCAACCAGGTGCTCTACTAGGAGATGACCAAATCTACAATGTAATCGTCACAGCTCATGCC
+TTTGTCATAATTTTCTTCATAGTTATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTTCCACTAA
+TGATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCACCCTCATT
+CCTCCTACTTCTAGCTTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTG
+GCTGGTAACATAGCCCATGCTGGAGCCTCAGTTGACCTTGCAATCTTCTCACTACACCTAGCAGGTATTT
+CTTCCATCCTAGGAGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATA
+TCAAACCCCCCTATTCGTATGATCCGTACTAATTACCGCAGTACTGCTCCTTCTCTCCCTACCCGTACTT
+GCTGCCGGAATTACTATGCTTCTAACAGACCGTAACCTCAATACCACATTCTTCGACCCAGCAGGAGGAG
+GAGACCCGGTACTATACCAGCACCTGTTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTACC
+AGGATTTGGTATTATTTCTCACGTCGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGA
+ATAGTATGAGCCATGCTATCCATCGGGTTCTTAGGCTTCATCGTTTGAGCACACCACATGTTTACAGTCG
+GAATGGACGTAGACACTCGAGCATACTTCACATCCGCCACCATAATCATTGCCATCCCAACCGGAATCAA
+AGTGTTCAGCTGACTGGCAACTCTTCACGGAGGAACAATCAAATGAGATCCACCAATGCTGTGAGCCCTA
+GGATTCATCTTCCTCTTCACTATTGGTGGACTAACAGGAATTGTCCTAGCAAACTCCTCCCTAGACATTG
+CCCTACACGACACTTACTACGTAGTAGCTCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAAT
+CCTAGCAGGATTTACCCACTGATTCCCACTATTCACCGGATACACCCTACACTCTACATGAGCTAAAATC
+CACTTCGGGGTGATATTCGTAGGAGTAAACCTTACTTTCTTCCCACAACACTTCCTTGGACTAGCTGGCA
+TGCCACGACGATACTCAGACTACCCAGACGCCTACACTCTATGAAACACTATCTCATCAGTAGGATCACT
+AATTTCCCTAACCGCCGTAATCATGCTGATATTTATCATCTGAGAAGCTTTCGCATCCAAACGTAAAGCC
+CTACAGCCAGAACTAGTCAATACAAACGTCGAATGAATCCACGGCTGCCCACCACCATTCCACACATTCG
+AAGAACCAGCCTTCGTTCAAGTTCAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACC
+GCATAAACCACTTATGCTTCTTTCTCATTTAGAGGTGTTAGTAAAACTATTACATAGTCTTGTCAAGACT
+AAATTACAGGTTAAAGCCCAGTACACCTCAACACAAATATGGCCAACCACATACAATTCGGTTTTCAAGA
+CGCTTCATCCCCTATCATAGAAGAACTAGTAGAATTTCACGACCACGCTCTAATAACTGCCCTAGCTATT
+TGCAGCCTGGTACTATACCTACTAACCATGATACTCACCGAAAAGCTATCATCCAGCACAGTCGATGCAC
+AAGAAATCGAACTTGTCTGAACAATCCTCCCTGCAATTGTCCTAATCATGCTTGCTCTACCATCCCTACA
+AATCCTCTACATAATGGATGAAATTAACGAGCCCGACCTGACACTAAAAGCCATTGGACACCAATGATAC
+TGATCTTACGAATACACCGACTTCAAGGACCTAACATTTGACTCTTACATGACACCAACTGCAGACCTAC
+CGTTAGGTCACTTCCGACTACTAGAAGTGGACCATCGTGTAGTTGTCCCAATGGAATCACTAGTTCGAGT
+CATCGTTACTGCCGACGACGTACTTCACTCATGAGCCGTCCCAAGCCTAGGCGTAAAAACTGACGCAATC
+CCAGGACGACTGAACCAAACCTCATTCACCGCCACTCGACCTGGAGTATTCTACGGTCAATGCTCAGAAA
+TTTGTGGGGCTAATCACAGCTTCATACCAATTGTAGTTGAATCTGCTCCACTCGCCAATTTCGAGAACTG
+ATCCTCTCTACTATCATCTTAATCATTAAGAAGCTATGAACCAGCGCTAGCCTTTTAAGCTAGAGAAAGA
+GGACTATTCATCCTCCTTAATGATATGCCTCAACTAAACCCAAACCCATGATTTTTTATCATGCTAGCTT
+CGTGACTCACCTACTCCATAATCATCCAACCTAAACTACTATCCTTTGTCTTCATAAACCCTCCAATCAG
+CAAAACCCAAACAACCCCAACCACCTCCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCT
+CAAGCCCATCCCTACTAGGTATTCCCCTAATCCTGATCGCAATAACATTCCCTGCCCTCCTGCTGTCAAC
+CCAAAACAACCGATGAATCACTGATCGCCTATCCACTTTACAATCATGATTCATCAGCCTAATTACAAAA
+CAGCTGATAATGCCACTAAGCAACAAGGGACATAAATGAGCCCTAATCCTAACATCGCTAATACTATTTC
+TCCTACTTATCAACCTGCTAGGCCTACTACCCTACACATTCACCCCAACAACCCAACTTTCTATAAACCT
+AGCTCTAGCAATTCCCCTATGACTTGCCACCCTGCTCACAGGACTACGAAACCAACCCTCAATCTCCCTA
+GCCCACCTCCTACCAGAAGGAACCCCAACTCCACTAATCCCAGCCCTAGTCCTCATTGAAACAACTAGCC
+TTCTTATTCGTCCCCTAGCCCTAGGCGTTCGCCTTACAGCCAACCTCACAGCAGGCCATCTATTAATCCA
+ACTTATCTCAACAGCCACTGCCTCCCTAGTCTCAACAATACCAATAATCTCACTACTAACATTATTAGTA
+TTATTCCTACTCACAGTCCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTATTTGTGCTACTACTAA
+GCCTGTATCTACAAGAAAACATTTAAACCACCAATGACTCACCAAGCACACTCTTATCACATAGTTGACC
+CAAGCCCATGACCCATCCTAGGAGCAGCCGCTGCTCTTCTTACTACATCCGGCCTAACCGTATGATTCCA
+CTACAACTCGCCATACCTACTGATCATAGGACTAACTTCTACTGCCCTGGTTATACTTCAATGATGACGT
+GACATCATCCGAGAAAGTACATTCCAAGGCCACCACACACCCACAGTACAAAAAGGCCTACGATATGGAA
+TAGTCCTATTCATCACATCAGAGGCCTTCTTCTTCCTAGGTTTCTTTTGAGCATTCTTCCACTCCAGCCT
+GGCCCCAACACCAGAGCTAGGAGGACAGTGACCTCCAGTCGGAATCAAACCTCTAAACCCAATGGACGTC
+CCCCTCCTAAACACCGCCATCCTACTTGCTTCAGGAGTCACAGTCACATGAGCACACCATAGCATCATAG
+AAGCTAACCGAAAACAAGCAATCCACGCCCTCACCCTTACAGTTCTCCTAGGCTTCTACTTCACCGGCCT
+GCAAGCCATAGAATACTACGAAGCTCCGTTCTCCATCGCTGACGGGGTATACGGTTCTACCTTCTTCGTA
+GCAACTGGCTTCCACGGCCTCCACGTAATCATTGGTTCCACATTCCTCCTAGTATGCCTTCTACGCCTAA
+TCAAATACCACTTTACACCAAAACACCATTTTGGCTTCGAAGCAGCAGCTTGATACTGACACTTTGTAGA
+CGTCGTATGACTATTCCTCTATATGACTATCTACTGATGAGGATCCTACTCTTCTAGTATATTAATTACA
+ATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATGAACATAATCCTATTCATAATA
+GTCTCATCTTTAACTCTAAGTGTCATCCTCACTGCATTAAACTTTTGACTAGCACAAATAAACCCAGACT
+CAGAGAAACTGTCCCCATACGAATGTGGATTTGACCCACTAGGGTCCGCCCGGCTGCCATTTTCAATTCG
+ATTTTTCCTAGTTGCAATCTTATTTTTACTATTTGACCTAGAAATTGCTCTGCTCCTTCCACTACCATGA
+GCCATCCAGCTACAAACCCCCACCCTTACACTAACATGGGCCTCCATCCTTATTCTTCTCCTTACTCTAG
+GTCTGGTTTATGAATGAAGCCAAGGAGGACTAGAATGAGCAGAATAACAGAAAGTTAGTCTAACCAAGAC
+AGTTGACTTCGACTCAACAGATTATAGCTAACGCCCTATAACTTTCTTAATGTCTGCCCTACAATTAAGC
+TTTTTTTCCGCCTTCACCCTAAGCGGCCTAGGCCTAGCCTTCCACCGCACACACTTAATCTCCGCCCTAC
+TATGTCTAGAAAGTATGATACTATCCATATACGTCGCCCTTTCCATGTGACCAATCCAGACCCAAACAAC
+ATCTGCTACCCTCCTACCACTTCTCATACTAGCATTCTCTGCTTGTGAGGCAGCAACAGGCCTAGCTCTA
+CTAGTCGCCTCCACCCGGACCCACGGCTCCGACCACCTGCACAACTTTAACCTACTACAATGCTAAAAAT
+CATTATTCCAACCATCATACTCCTACCACTGACCTTCCTCTCCCCCTACAAACACCTATGAACTAACACC
+ACAACACACAGCCTATTAATTGCCGCTGTCAGCCTCCAATGACTAGTCCCAACATACTACCCAAGCAAAG
+GACTAACCCATTGAACCTCAATTGACCAAATCTCCTCCCCCCTACTAGTTCTATCGTGCTGACTACTCCC
+ACTCATACTCATAGCAAGCCAAAACCACCTAGAACAAGAGCCAATCATCCGTAAACGAATCTTCATCACA
+ACTATAATCACAGTACAGCCCTTTATCCTGCTGGCTTTCTCAGCTTCAGAACTAATACTATTCTACATCG
+CATTTGAAGCAACCCTAATTCCAACCCTAATCCTTATCACACGATGAGGAAACCAACCCGAACGACTGAA
+CGCAGGCATTTACCTGCTATTTTATACACTCGCCAGCTCTCTTCCTCTGCTGATCACAATCCTCCACCTA
+CATAACCAAATTGGCACATTATACCTCCCTATACTCAAACTATCGCACCCAACAATAAACAACTCTTGAA
+CAGGCCTACTAGCAAGCTTAGCCCTCCTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGTCTTCATCT
+ATGACTCCCAAAAGCACATGTAGAAGCCCCAATCGCCGGATCCATGCTACTAGCCGCTCTCCTCCTAAAA
+CTTGGCGGCTACGGCATTATACGAATCACTATCCTAGTAAACCCCTCTGTAAACAACCTACACTACCCAT
+TCATTACTTTAGCACTATGAGGAGCAGTAATAACCAGTGCCATCTGCCTACGACAAATCGACCTAAAGTC
+CCTAATTGCTTACTCCTCTGTAAGCCATATAGGACTAGTCATCGCCGCAACCATAATTCAAACCCAATGA
+GCCTTCTCAGGGGCAATAATCCTAATAATCTCTCACGGCCTAACCTCCTCTATACTATTCTGCCTGGCCA
+ATACAAACTACGAACGAACTCACAGCCGAATCCTACTTCTAACCCGAGGACTTCAACCCCTCCTACCACT
+TATGGCCACCTGATGACTACTAGCAAACCTAACAAACATGGCACTACCACCAACAACCAACCTCATAGCA
+GAACTAACCATTGTAGTAGCCCTGTTCAACTGATCCCCACTGACAATCATTTTAACAGGAACTACAATCG
+TACTAACTGCCTCTTATACCCTACATATGCTAATAACAACACAACGAGGAATACTACCATCCCACATCAC
+CTCAATCCAAAATTCCTCAACACGAGAACATCTCCTGATGGCCCTACACATAATTCCCATAATCCTACTT
+ATTCTCAAACCTGAACTAATCTCAGGAATCCCTATATGCAAGTATAGTTTAATCAAAACATTAGATTGTG
+ATTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGGAGGTTAAACCAACAAGAACTGCTAATTC
+TTGCATCTGAGTATAAAACCTCAGCCCCCTTACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAAC
+CAGTCATCTTGGTGCAAATCCAAGTGAAAGTAATGGACCAAATACTTATCCTAAACACATTCATACTACT
+CACCCTAGCAGTACTCTGCACCCCAATCATCTTCCCCATACTATCAAGCAGCCTAAAAAACACTCCAACT
+ATCATTACAAACACTGTCAAAACTTCCTTCCTAATCAGCCTGATCCCCATAACCATCTACATTCACTCAG
+GAATAGAAAGTCTAACTTCCTTCTGGGAATGAAAATTCATTATAAACTTTAAAATTCCTATCAGCCTAAC
+AATAGACTTCTACTCACTGACTTTCTTCCCAATTGCCCTATTTGTCTCCTGATCAATCCTACAATTTGCA
+ACATGATACATAGCCTCAGACCCGCACGTCGCAAAATTTTTCACCTTCCTCCTCCTATTCCTTATTGCCA
+TGCTCATCCTGATTATCTCCAACAACCTGTTCCTACTCTTCATCGGATGAGAAGGAGTAGGAATCATATC
+CTTCCTACTAATCAGCTGATGACATGGCCGAGCAGAAGCAAATACCGCTGCCCTACAGGCCGTACTATAC
+AACCGAGTCGGAGATGTAGGCCTTATCCTGTGCATGGCATGACTAGCTTCCACCATAAACACATGAGAAA
+TTCAACAAATCTCATCTCAGGACCAAACTCCTACCCTACCACTACTAGGCTTAATTTTAGCTGCGGCCGG
+CAAATCCGCCCAATTTGGCCTCCACCCGTGACTCCCAGCAGCAATAGAAGGCCCAACCCCTGTATCCGCC
+TTACTTCATTCCAGCACCATAGTAGTCGCCGGGATCTTCCTACTTATCCGAACTCACCCCCTCTTCCACA
+ACAACCCCACTGCACTATCACTATGCCTATGCCTGGGAGCCCTCTCCACACTATTCGCAGCCACTTGCGC
+CCTGACCCAAAATGATATCAAAAAAATCATTGCTTTTTCCACATCCAGCCAACTAGGCCTAATAATAGTT
+ACAATCGGCCTAAATCTTCCCCATCTAGCCTTCCTGCATATTTCAACCCACGCATTCTTCAAAGCCATGC
+TATTCCTATGTTCAGGGTCAATCATTCACAGCCTCAACGGCGAACAAGACATTCGAAAAATAGGAGGACT
+TCAAAAAATACTACCAACAACAACCTCATGCCTAACTATCGGAAACCTAGCCCTGATAGGAACACCATTT
+CTGGCAGGATTCTACTCCAAAGACCAAATTATCGAAAGCCTCAACACCTCGTACTTAAACGCTTGAGCCC
+TAGTTCTAACTCTCCTAGCTACATCATTCACCGCAGTATATACTATTCGAATAACCCTATTAGTTCAAAC
+AGGATACGTCCGAATTCCTCCCCTAACCCCCATGAACGAAAATAACCCAGCAGTCCTCTCCTCAATCACT
+CGACTTGCACTAGGAAGCATTGTAGCAGGATTCCTAATCACCTCATATATTCCACCTGCAAAAACCCCAC
+CAATAACTATACCACTATCCATTAAAGTCACGGCCCTTGTAGTAACACTACTAGGAATCATCCTAGCCCT
+AGAACTCTCAAAACTAACTCAAGCTTTAATCCTCCCTAAACAGAATCGCTTCTCAAATTTCTCTACAGCC
+CTAGGATACTTTAATCCCCTAGTACACCGATTTATCCCAACAAAAATACTAAGCGGCGGCCAAAACATTG
+CCTCCCACCTAATTGACCTCTCTTGATTCAAACTTCTAGGCCCTGAAGGGTTAGCCAACCTACAAATAAT
+AGCATCAAAAACCGCTACCTCCTTCCACACAGGCCTAATTAAAGCCTACCTAGGATCATTTGCCTTATCA
+ATCTTTATCATCCTCCTATCCACATACAGAACCAAACTTAATGGCCCTAAATCTACGAAAAAATCACCCA
+CTACTAAAAATCATCAACAACTCCCTAGTTGACCTTCCCACTCCATCAAACATTTCAGCTTGATGAAACT
+TCGGATCCCTACTAGGCCTATGCCTCATCACACAAATTGTCACAGGCCTACTACTAGCCATACATTACAC
+AGCAGACACCTCCCTAGCCTTCGCTTCCGTAGCCCACATATGCCGAGACGTACAATTCGGATGACTAATC
+CGAAACCTCCACGCAAATGGGGCCTCCTTCTTTTTCATTTGCATCTACCTACATATTGGCCGAGGATTCT
+ATTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTAGTCCTTCTTCTAACACTAATAGCAAC
+TGCCTTCGTAGGATACGTCCTGCCATGAGGACAAATATCTTTCTGAGGAGCTACAGTCATTACAAACCTT
+TTCTCAGCAATCCCATACATTGGACAAACATTAGTAGAATGACTATGAGGCGGGTTCTCAGTAGACAACC
+CCACACTAACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTGTAATCGCAGGCCTGACACTAGTACA
+CTTAACCTTCCTCCACGAAACAGGCTCAAACAACCCACTAGGAATCCCCTCAGATTGCGACAAAATTCCA
+TTCCACCCTTACTACTCCATCAAAGACCTACTAGGATTCGCACTAATACTCGTCCCATTCGTCACTCTGG
+CCCTATTTTCCCCAAACCTCCTAGGAGACCCAGAAAATTTCACGCCCGCCAACCCCCTGGCCACACCTCC
+CCACATTAAACCCGAATGATACTTCCTATTTGCATACGCCATTCTCCGATCCATCCCAAACAAACTAGGA
+GGAGTCCTAGCTCTAGCCGCCTCAGTCCTAGTCCTATTCCTAATACCTCTCCTCCACACGTCTAAACAAC
+GTTCCATAACCTTTCGACCCCTATCACAAATCCTATTCTGAGCTCTAGTCGCAGACCTCTTCATCCTAAC
+ATGAGTAGGAAGCCAACCAGTCGAACACCCATTCATCATCATTGGCCAACTAGCCTCCTTCACCTACTTC
+GCAATCATCCTAATCCTGTTCCCTATCGCGAGTGCACTAGAAAACAAAATACTAAAACTCTAATCAACTC
+TAATAGTTTATAAAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACATCTTCTTAGAGTTAACAC
+ATAAATCAGAAAGAAAGGAGTCAAACCTTTATCACCAACTCCCAAAGCTGGCATTCTCAATTAAACTACT
+CTCTGACCTACCAATTAAACCGCCCGAATTGCCCCCCGAGATAACCCCCGCACAAGTTCTAAAACCACAA
+ACAGTGTTAATAACAGGCCTCATCCTGCAATTAAAAGCAGCCCTGACCCAGACGAATAGAACATAGCTAC
+TCCACTAAAATCCGTCCGAGTTCACGATAGACCTCCATTATTCACCGTATCCCCTCCCATAATCACTTCA
+GAAAACACCCCTGTAGCAAACCCCACAATAACAACGACTAACCCCAGACCAACACCATAACCAACAACCC
+GTCAATCACCCCAAGATTCCGGATAAGGATCCGCTGCCAGAGACACTGAATAAACAAATACCACCAGCAT
+CCCCCCTAAATATACCATCACCAGTACAAGAGAAACAAAAGAAACCCCCATACTTACCAGTCACCCACAT
+CCAGCAATAGAAGCCACAACCAGACCCACCACCCCATAATAAGGAGAAGGGTTAGACGCAACCGCTAACC
+CTCCTAAAACAAAGCATAGACTCATAAAAAGAACAAAGTTTATCATAGTTCCTGCTTGGATCCTCCCCAA
+GACCTATGGCTTGAAAAACCATTATTATAAAACTTTAACTACAGGAACTAAACCCTACTCTCATCCACCC
+CCCCCCCTTACCCCCCCCATGTTTTTACATGGGATTTTGGCTATGTATTTCTTTGCATACAATTCTCGTC
+CACATTAGACATAATATGCATGTAGGATAACTCACATAACAAGTAATGCAAGACCTAACCAAACTCAAAT
+ATCATCGCCCATAACACCCCAAACGGACAGATAACCTTCCAGGCACATCCCCATCGCAGGCACAACAAAC
+CCAGGTAATCCTACCAACGACACAAGACAAGCTTCGCCCAAGATCGAGAATGTTTTACCTTACATAACAA
+CGCACTCTCGTAAACGAGGAATATCCTAGTACCCCAATGAATTCTTAATCCCATACGTTTCAGTCCATCA
+CCACAAAACCTCCTAGTCCTATCACTCTCAAGAGCTCCCAAGAAGGACCTGGTTATTTATTAGTCGTAAT
+CCTCACGAGAACCGAGCTACTCAACGTAGGTGCTACCCACGGCTACCAGCTTCAAGGCCATACTTTCCCC
+CTACACCCTCGCCCAACTTGCGCTTTTGCGCCTCTGGTTCCTATTTCAGGGCCATAACTTGGACCTTTCC
+CTCCTTATCGCTCTTCACAGATGCAAGTGGTCGGATGCATAATCCTCCCTTTGCCTCGTGATCGCGGCAT
+CCGACCGACTTGGCGCTTGTTTTCTTTTTGGGGTCTCTTCATTAAACCCTTCAAGTGCGTAGCAGGAGTT
+ATCTTCCTCTTGACGTGTACATCACATGGCATCCGAGCGGCTATTTGTCTGTAATGTACCTGGTGTCATG
+GTTGTTCGGATAAGGTCGTCTCAAACTTGACACTGATGCACTTTTACCCCATTCATGGTGGGTCCCCCAG
+CTACCTATACGGTGGCAGATAATGTTATGGTTGCCGGACATAGTTTGTTATTTTTCCTTTACTAGGAATT
+ATCACCCAAACCTTCATTTTCATTCTTTTTTTTATCGTTTATTTTTATGTTGTAATTTTAACAAAATAAA
+CAACAACTTTTATATGATATTAACCTAGATTTTCCAAACCATTCATCGTTCGTTCATTAACACTTAACTT
+TCCTCTGCCTTTCCCCTATTTTTAACCCAACAAATCAATGACTTTCATCATAACTTCCACAACCACCAAC
+TTAGCCAAATTACACAAAACAAACAAACCAATTAAAAACAAGATAAAAGTACACACCCTTTACACACAAC
+CACACTAAACACACAACAAAACTTAACACACTATATGCCACAATACTACTTTTCATTTATAAAAAAAACA
+AGATAAAAATACAAAACATCAATACCAATAATAAGTCCAAAATACTACATTCGCTT