summaryrefslogtreecommitdiffstats
path: root/dat/csf.txt
blob: 0fd2e6142de2bd9e2de3152f5ce8e832e1d0b0ea (plain)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
104
105
106
107
108
109
110
111
112
113
114
115
116
117
118
119
120
121
122
123
124
125
126
127
128
129
130
131
132
133
134
135
136
137
138
139
140
141
142
143
144
145
146
147
148
149
150
151
152
153
154
155
156
157
158
159
160
161
162
163
164
165
166
167
168
169
170
171
172
173
174
175
176
177
178
179
180
181
182
183
184
185
186
187
188
189
190
191
192
193
194
195
196
197
198
199
200
201
202
203
204
205
206
207
208
209
210
211
212
213
214
215
216
217
218
219
220
221
222
223
224
225
226
227
228
229
230
231
232
233
234
235
236
237
238
239
240
241
242
243
>gi|669032233|ref|NC_024607.1| Corvus splendens mitochondrion, complete genome
GTCCATGTAGCTTACAATAAAGCATGACACTGAAGATGTCAAGACGGCTGCCACAAACACCCATGGACAA
AAGACTTAGTCCTAACCTTACTGTTGGTTTTTGCCAGAATTATACATGCAAGTATCCGCATTCCAGTGTA
AATGCCCTAGGCACCCTTTAACCAAGTCGATAGGAGCGGGTATCAGGCACACACAATTGTAGCCCAAGAC
GCCTTGCACTTGCCACACCCCCACGGGTATTCAGCAGTGGTTAACATTAAGCAATGAGTGTAAACTTGAC
TTAGTCATGGCAACCTTAAGGGTCGGTAAATCCTGTGCCAGCCACCGCGGTCATACAGGAGACTCAAATT
AACAGTATAACGGCGTAAAGGGTGGTAACATGCTATCTAAGTAACTAAGATTAAAAAGCAACTGAGCTGT
AATAAGCCCAAGATGCTCATAAGGCCAACTACCAAAGAAGATCTTAGACTGACGATTAATTGAAATCCAC
GAAAGCCAGGGCCCAAACTGGGATTAGATACCCCACTATGCCTGGCCCTAAATCTTGATGCTCTATGCTA
CCTGAGCATCCGCCCGAGAACTACGAGCACAAACGCTTAAAACTCTAAGGACTTGGCGGTGTCCCAAACC
CACCTAGAGGAGCCTGTTCTGTAATCGATGATCCACGATATTACCTGACCACTCCTTGCTGAATCAGCCT
ACATACCGCCGTCGCCAGCCCACCCCCCCTGATGGTTCAACAGTGAGCGCAATAGTCCCTACCCACTAGT
AAGACAGGTCAAGGTATAGCCCATGGAGTGGAAGTAATGGGCTACATTTTCTAGTTTAGAACATCACGGC
AAAAGGGTCTGAAATGGCCCTTAGAAGGCGGATTTAGCAGTAAAGTGGGACAATCGAGCCCTCTTTAAGC
CGGCTCTGGGATGCGTACATACCGCCCGTCACCCTCCTCACAAGCGACCCAAACCCCCCAATACATTAAT
ACGCTATCCAGCTAAAGAGGAGGCAAGTCGTAACAAGGTAAGTGTACCGGAAGGTGCACTTAGACAACCA
AGACGTAGCTTAGACGAAAGCATTCAGCTTACACCTGAAAAACATCTGCTAACACCAGATCGTCTTGATG
CCAAATTCTAGCCCAACCACATTGACCTGGAATAACAAAGCTACTACATACACCAAACTAAAGCATTCAC
TAGTCTTAGTATAGGCGATAGAAAAGACACCAATTGGAGCGATAGAGATCACGTACCGTAAGGGAAAGAT
GAAATAATAATGAAAAAACTAAGCTATAAACAGCAAAGATCAACCCTTGTACCTTTTGCATCATGGTCTA
GCAAGAAAAACCAAGCAAAATGAGTTTAAGTTTGCCACCCCGAAACCTAAGCGAGCTACTTGTGAGCAGC
TATTGTTGAGCGAACCCGTCTCTGTTGCAAAAGAGTGGGACGACTTACTAGTAGAGGTGAAAAGCCAATC
GAGCTGGGTGATAGCTGGTTGCCTGTGAAACGAATCTTAGTTCACTCTTAATTCTTCTCCAAGGAAACTA
ATAGAACCCTAATGAAGCGAATTAAGGGCAATTTAAAGGGGGTACAGCTCCTTTAAAAAAGAATACAATC
TCTACGAGCGGATAAATAATCTATAGAAAGATTTCCTGTGGGCCTTCAAGCAGCCATCAACAAAGAGTGC
GTTAAAGCTCTTCGACTAAAAAATATAAGAACTTCATGACTCCCTCATCATTAACAGGCTAACCTATATG
TAAATAGGAGAATTAATGCTAGAATGAGTAACCAGGGTCCTCCCTCTACGACGCAAGCTTACATCTTTAC
ATTATTAACAAATCACCAAGATACGACAAATCAAACAAGCAGAGTATCAGGTAAATTGTTAACCCGACAG
AGGAGCGTCCATTAAGAAAGATTAAAACCTGTAAAAGGAACTAGGCAAACACATCAAGGCCCGACTGTTT
ACCAAAAACATAGCCTTCAGCAAACAGCAAACAAGTATTGAAGGTGATGCCTGCCCTGTGACTTAGTGTT
TAACGGCCGCGGTATCCTAACCGTGCAAAGGTAGCGCAATCAATTGTCTCATAAATCGGGACCAGTATGA
ATGGCTAAACGAGGTCTTAACTGTCTCTTACAGGCGATCGGTGAAATTGATCTCCCTGTGCAAAAGCAGG
GATAACTACATAAGACGAGAAGACCCTGTGGAGCTTAAAAATCAGCAGCCACCCCTACACACATTCACTC
CCACTGGGTACACGCTCATACAGGGAACTGGCCTGCATTTTTCGGTTGGGGCGACCTTGGAGAAAAACAA
ATCCTCCAAAAATTAGACCACAACTCTAGACTGAGAGCGACCCCTCAACGTGCGAATAGCACCCAGACCC
AATATAATTGATCAATGGACCAAGTTACCCCAGGGATAACAGCGCAATCTCCTCCGAGAGTCCGTATCGA
CGGGGAGGTTTACGACCTCGATGTTGGATCAGGACATCCTAGTGGTGCAGCCGCTACTAAGGGTTCGTTT
GTTCAACGATTAATAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCCATCTATGA
TGAACTCTTCCCAGTACGAAAGGACAGGAAAAGTGAGGCCAATACTACAAGCAAGCCTTCGCCTTAAGTG
ATGAATCCAACTAAATTACGAAAGGCTATCACACTACAACCATGTCCTAGAAAAGGACTAGCTAGCGTGG
CAGAGCTCGGAAAATGCAAAAGGCTTAAGTCCTTTATATCAGAGGTTCAAATCCTCTCCCTAGCTAAACT
TAAAATGGCCAACTATCCCATCCTAGTCAACCTCATTATAGCACTTTCTTATGCCATCCCCATTCTAATT
GCCGTAGCCTTTTTAACCCTAGTAGAACGTAAAATCCTAAGTTACATACAAGGCCGAAAAGGGCCCAACG
TTGTAGGCCCTTTCGGGCTCCTGCAGCCAGTAGCAGATGGGGTAAAGCTATTCATCAAAGAACCAATCCG
CCCATCAACATCCTCCCCAATTCTATTTATTACCACCCCAATACTAGCCCTCCTACTAGCAATCTCCATC
TGAACCCCACTTCCAATCCCATTCCCACTTGCAGATCTAAACCTAGGACTGCTATTCATATTAGCCATGT
CAAGCCTAGCAGTATACTCAATCCTATGATCTGGCTGAGCCTCCAACTCAAAATACGCCCTAATCGGATC
TCTACGGGCAGTAGCCCAGACAATTTCATACGAGGTCACCCTAGCAATCATCCTACTATCCATCATCCTT
CTCAGTGGAAATTATACTCTAAGCACCCTAGCAGTTGTTCAAGAGCCCCTATTTCTTATCTTCTCCTGCT
GACCCCTCGCCATAATATGATATGTATCTACACTGGCCGAAACAAATCGTGCCCCATTCGACCTCACAGA
AGGGGAATCAGAACTAGTCTCAGGATTCAACGTAGAATATGCCGCAGGGCCCTTCGCTTTATTCTTCCTA
GCAGAATACGCGAACATCATGCTCATAAACGCACTAACCGTAATCCTGTTCTTCAACCCAAGCCTATACA
ATCCACCTCAAGAACTCTTCCCCGTAATTCTAGCCACAAAAGTCCTACTCCTGTCCATAGGATTCCTATG
AATTCGTGCCTCCTACCCACGATTCCGATATGATCAGCTAATGCATTTACTATGAAAAAACTTCCTCCCA
CTAACGCTCGCTCTATGTCTGTGACACATTAGCATACCAATTTCCTACGCAGGCCTACCTCCTTACCTAA
GGAGCCACCAGGAAATGTGCCTGAACGTCAAAAGGGTCACTATGATAAAGTGAACATAGAGGTACACCAG
CCCTCTCATTTCCTACACCTTAGAAAAACAGGAATCGAACCTGTACAAGAGAGATCAAAACCCTCCATAC
TTCCTTTATATTATTTTCTAGTAGGGTCAGCTAATCAAGCTATCGGGCCCATACCCCGAAAATGATGGTT
TAACCCCTTCCCCTGCTAATGAACCCCCAGGCAAAACTGATTTTTATCACTAGCCTACTCCTAGGAACAA
CCATCACAATTTCAAGCAACCATTGAGTCATGGCCTGAACCGGCCTTGAAATCAACACACTCGCTATTCT
GCCCCTAATTTCAAAATCCCACCATCCCCGAGCTATTGAGGCAGCAACCAAATATTTTCTAGTTCAAGCA
ACTGCCTCAACTCTGGTACTATTCTCCAGCATAACCAATGCATGGTACACTGGGCAATGAGATATCACCC
AGCTAACCCACCCAGCATCCTCCCTAATCCTAACCGCAGCTATTTCAATGAAGCTTGGACTAGTACCCTT
TCACTTCTGATTCCCAGAAGTCCTACAAGGCTCCCCCCTCATTACTGGCCTTCTCCTGTCCACAGCCATG
AAATTTCCACCAATTACCCTACTCTACATAACCTCCCTATCCCTAAACCCCACACTACTAACCACCCTGG
CCGTTCTTTCTGTAGCCATAGGAGGCTGAATAGGACTAAACCAAACACAAGTCCGAAAAATTATGGCCTT
CTCCTCTATCTCACACCTAGGCTGAATGGCCATTATCTTAATCTACTACCCCAAACTTACTCTACTCAAC
TTCTACCTGTATGCCATAATAACCGCTGCCGTATTCCTAACCCTAAACTCAATAAAAGTCCTAAACCTAT
CCACACTAATAACTGCATGAACAAAAGCACCTGCACTTAGCACAATCCTCCTACTAACACTTCTGTCCCT
GGCCGGCCTCCCCCCTTTAACCGGCTTCCTCCCAAAATGACTCATTATTCAAGAACTAACCAAACAGGAC
ATAGCTCCGGCAGCAATTATTATCTCCCTTCTTTCACTACTGGGTCTCTTCTTCTACCTCCGTCTTGCGT
ATTGTGCAACAATCACACTTCCGCCCCACACAACAAACCACATGAAACAATGACGTACCAACAAACCAGT
TAGCCCCTCAATTGCCATTTTAACAACCCTATCCATCATGCTCCTCCCAACTTCCCCCATACTCACTACC
ATTATTTAAAGAGAAACTTAGGTTTACTGAAACCGAAGGCCTTCAAAGCCTTAAACAAGAGTTAGACCCT
CTTAGTTTCTGTTAAAATCCGCAGGACGTTATCCTGCATCTTCTGAATGCAACTCAGATGCTTTAATTAA
GCTAGGATTTTGCACCTCTAGACAGATGGGCTTCGATCCCATGATACTATAGTTAACAGCTATATGCCCT
AAACCAACAGGCTTCTGCCTAACAGACTCCGGTGCACTGTCAGTGCACATCGATGAGCTTGCAACTCACC
ATGAACTTCACTACAGAGCCGATAAGAAGAGGAATTGAACCTCTGTGAAAAGGACTACAGCCTAACGCTT
ATACACTCAGCCATCTTACCCGTGACTTTCATCAACCGATGACTATTCTCAACCAACCACAAAGACATTG
GCACTCTGTACCTAATCTTCGGAGCATGAGCCGGAATAGTAGGTACCGCCCTAAGTCTCCTTATTCGAGC
AGAACTGGGCCAACCAGGTGCTCTACTAGGAGATGACCAAATCTACAATGTAATCGTCACAGCTCATGCC
TTTGTCATAATTTTCTTCATAGTTATGCCAATCATGATCGGAGGATTTGGAAACTGACTAGTTCCACTAA
TGATTGGTGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTCCTACCACCCTCATT
CCTCCTACTTCTAGCTTCTTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACTGTGTACCCACCACTG
GCTGGTAACATAGCCCATGCTGGAGCCTCAGTTGACCTTGCAATCTTCTCACTACACCTAGCAGGTATTT
CTTCCATCCTAGGAGCAATTAACTTCATTACCACAGCAATCAACATAAAACCTCCAGCCCTATCACAATA
TCAAACCCCCCTATTCGTATGATCCGTACTAATTACCGCAGTACTGCTCCTTCTCTCCCTACCCGTACTT
GCTGCCGGAATTACTATGCTTCTAACAGACCGTAACCTCAATACCACATTCTTCGACCCAGCAGGAGGAG
GAGACCCGGTACTATACCAGCACCTGTTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATTCTACC
AGGATTTGGTATTATTTCTCACGTCGTAGCATACTACGCAGGAAAAAAAGAACCATTTGGCTACATAGGA
ATAGTATGAGCCATGCTATCCATCGGGTTCTTAGGCTTCATCGTTTGAGCACACCACATGTTTACAGTCG
GAATGGACGTAGACACTCGAGCATACTTCACATCCGCCACCATAATCATTGCCATCCCAACCGGAATCAA
AGTGTTCAGCTGACTGGCAACTCTTCACGGAGGAACAATCAAATGAGATCCACCAATGCTGTGAGCCCTA
GGATTCATCTTCCTCTTCACTATTGGTGGACTAACAGGAATTGTCCTAGCAAACTCCTCCCTAGACATTG
CCCTACACGACACTTACTACGTAGTAGCTCACTTCCACTACGTACTATCCATAGGAGCAGTATTTGCAAT
CCTAGCAGGATTTACCCACTGATTCCCACTATTCACCGGATACACCCTACACTCTACATGAGCTAAAATC
CACTTCGGGGTGATATTCGTAGGAGTAAACCTTACTTTCTTCCCACAACACTTCCTTGGACTAGCTGGCA
TGCCACGACGATACTCAGACTACCCAGACGCCTACACTCTATGAAACACTATCTCATCAGTAGGATCACT
AATTTCCCTAACCGCCGTAATCATGCTGATATTTATCATCTGAGAAGCTTTCGCATCCAAACGTAAAGCC
CTACAGCCAGAACTAGTCAATACAAACGTCGAATGAATCCACGGCTGCCCACCACCATTCCACACATTCG
AAGAACCAGCCTTCGTTCAAGTTCAAGAAAGGAAGGAGTCGAACCCCCATATGTTGGTTTCAAGCCAACC
GCATAAACCACTTATGCTTCTTTCTCATTTAGAGGTGTTAGTAAAACTATTACATAGTCTTGTCAAGACT
AAATTACAGGTTAAAGCCCAGTACACCTCAACACAAATATGGCCAACCACATACAATTCGGTTTTCAAGA
CGCTTCATCCCCTATCATAGAAGAACTAGTAGAATTTCACGACCACGCTCTAATAACTGCCCTAGCTATT
TGCAGCCTGGTACTATACCTACTAACCATGATACTCACCGAAAAGCTATCATCCAGCACAGTCGATGCAC
AAGAAATCGAACTTGTCTGAACAATCCTCCCTGCAATTGTCCTAATCATGCTTGCTCTACCATCCCTACA
AATCCTCTACATAATGGATGAAATTAACGAGCCCGACCTGACACTAAAAGCCATTGGACACCAATGATAC
TGATCTTACGAATACACCGACTTCAAGGACCTAACATTTGACTCTTACATGACACCAACTGCAGACCTAC
CGTTAGGTCACTTCCGACTACTAGAAGTGGACCATCGTGTAGTTGTCCCAATGGAATCACTAGTTCGAGT
CATCGTTACTGCCGACGACGTACTTCACTCATGAGCCGTCCCAAGCCTAGGCGTAAAAACTGACGCAATC
CCAGGACGACTGAACCAAACCTCATTCACCGCCACTCGACCTGGAGTATTCTACGGTCAATGCTCAGAAA
TTTGTGGGGCTAATCACAGCTTCATACCAATTGTAGTTGAATCTGCTCCACTCGCCAATTTCGAGAACTG
ATCCTCTCTACTATCATCTTAATCATTAAGAAGCTATGAACCAGCGCTAGCCTTTTAAGCTAGAGAAAGA
GGACTATTCATCCTCCTTAATGATATGCCTCAACTAAACCCAAACCCATGATTTTTTATCATGCTAGCTT
CGTGACTCACCTACTCCATAATCATCCAACCTAAACTACTATCCTTTGTCTTCATAAACCCTCCAATCAG
CAAAACCCAAACAACCCCAACCACCTCCCCCTGAACCTGACCATGAACCTAAGCTTCTTCGACCAATTCT
CAAGCCCATCCCTACTAGGTATTCCCCTAATCCTGATCGCAATAACATTCCCTGCCCTCCTGCTGTCAAC
CCAAAACAACCGATGAATCACTGATCGCCTATCCACTTTACAATCATGATTCATCAGCCTAATTACAAAA
CAGCTGATAATGCCACTAAGCAACAAGGGACATAAATGAGCCCTAATCCTAACATCGCTAATACTATTTC
TCCTACTTATCAACCTGCTAGGCCTACTACCCTACACATTCACCCCAACAACCCAACTTTCTATAAACCT
AGCTCTAGCAATTCCCCTATGACTTGCCACCCTGCTCACAGGACTACGAAACCAACCCTCAATCTCCCTA
GCCCACCTCCTACCAGAAGGAACCCCAACTCCACTAATCCCAGCCCTAGTCCTCATTGAAACAACTAGCC
TTCTTATTCGTCCCCTAGCCCTAGGCGTTCGCCTTACAGCCAACCTCACAGCAGGCCATCTATTAATCCA
ACTTATCTCAACAGCCACTGCCTCCCTAGTCTCAACAATACCAATAATCTCACTACTAACATTATTAGTA
TTATTCCTACTCACAGTCCTAGAAGTAGCAGTAGCCATAATCCAAGCCTACGTATTTGTGCTACTACTAA
GCCTGTATCTACAAGAAAACATTTAAACCACCAATGACTCACCAAGCACACTCTTATCACATAGTTGACC
CAAGCCCATGACCCATCCTAGGAGCAGCCGCTGCTCTTCTTACTACATCCGGCCTAACCGTATGATTCCA
CTACAACTCGCCATACCTACTGATCATAGGACTAACTTCTACTGCCCTGGTTATACTTCAATGATGACGT
GACATCATCCGAGAAAGTACATTCCAAGGCCACCACACACCCACAGTACAAAAAGGCCTACGATATGGAA
TAGTCCTATTCATCACATCAGAGGCCTTCTTCTTCCTAGGTTTCTTTTGAGCATTCTTCCACTCCAGCCT
GGCCCCAACACCAGAGCTAGGAGGACAGTGACCTCCAGTCGGAATCAAACCTCTAAACCCAATGGACGTC
CCCCTCCTAAACACCGCCATCCTACTTGCTTCAGGAGTCACAGTCACATGAGCACACCATAGCATCATAG
AAGCTAACCGAAAACAAGCAATCCACGCCCTCACCCTTACAGTTCTCCTAGGCTTCTACTTCACCGGCCT
GCAAGCCATAGAATACTACGAAGCTCCGTTCTCCATCGCTGACGGGGTATACGGTTCTACCTTCTTCGTA
GCAACTGGCTTCCACGGCCTCCACGTAATCATTGGTTCCACATTCCTCCTAGTATGCCTTCTACGCCTAA
TCAAATACCACTTTACACCAAAACACCATTTTGGCTTCGAAGCAGCAGCTTGATACTGACACTTTGTAGA
CGTCGTATGACTATTCCTCTATATGACTATCTACTGATGAGGATCCTACTCTTCTAGTATATTAATTACA
ATCGACTTCCAATCCTTAAAATCTGGTTTAAACCCAGAGAAGAGTAATGAACATAATCCTATTCATAATA
GTCTCATCTTTAACTCTAAGTGTCATCCTCACTGCATTAAACTTTTGACTAGCACAAATAAACCCAGACT
CAGAGAAACTGTCCCCATACGAATGTGGATTTGACCCACTAGGGTCCGCCCGGCTGCCATTTTCAATTCG
ATTTTTCCTAGTTGCAATCTTATTTTTACTATTTGACCTAGAAATTGCTCTGCTCCTTCCACTACCATGA
GCCATCCAGCTACAAACCCCCACCCTTACACTAACATGGGCCTCCATCCTTATTCTTCTCCTTACTCTAG
GTCTGGTTTATGAATGAAGCCAAGGAGGACTAGAATGAGCAGAATAACAGAAAGTTAGTCTAACCAAGAC
AGTTGACTTCGACTCAACAGATTATAGCTAACGCCCTATAACTTTCTTAATGTCTGCCCTACAATTAAGC
TTTTTTTCCGCCTTCACCCTAAGCGGCCTAGGCCTAGCCTTCCACCGCACACACTTAATCTCCGCCCTAC
TATGTCTAGAAAGTATGATACTATCCATATACGTCGCCCTTTCCATGTGACCAATCCAGACCCAAACAAC
ATCTGCTACCCTCCTACCACTTCTCATACTAGCATTCTCTGCTTGTGAGGCAGCAACAGGCCTAGCTCTA
CTAGTCGCCTCCACCCGGACCCACGGCTCCGACCACCTGCACAACTTTAACCTACTACAATGCTAAAAAT
CATTATTCCAACCATCATACTCCTACCACTGACCTTCCTCTCCCCCTACAAACACCTATGAACTAACACC
ACAACACACAGCCTATTAATTGCCGCTGTCAGCCTCCAATGACTAGTCCCAACATACTACCCAAGCAAAG
GACTAACCCATTGAACCTCAATTGACCAAATCTCCTCCCCCCTACTAGTTCTATCGTGCTGACTACTCCC
ACTCATACTCATAGCAAGCCAAAACCACCTAGAACAAGAGCCAATCATCCGTAAACGAATCTTCATCACA
ACTATAATCACAGTACAGCCCTTTATCCTGCTGGCTTTCTCAGCTTCAGAACTAATACTATTCTACATCG
CATTTGAAGCAACCCTAATTCCAACCCTAATCCTTATCACACGATGAGGAAACCAACCCGAACGACTGAA
CGCAGGCATTTACCTGCTATTTTATACACTCGCCAGCTCTCTTCCTCTGCTGATCACAATCCTCCACCTA
CATAACCAAATTGGCACATTATACCTCCCTATACTCAAACTATCGCACCCAACAATAAACAACTCTTGAA
CAGGCCTACTAGCAAGCTTAGCCCTCCTACTAGCCTTCATAGTTAAAGCCCCCCTATACGGTCTTCATCT
ATGACTCCCAAAAGCACATGTAGAAGCCCCAATCGCCGGATCCATGCTACTAGCCGCTCTCCTCCTAAAA
CTTGGCGGCTACGGCATTATACGAATCACTATCCTAGTAAACCCCTCTGTAAACAACCTACACTACCCAT
TCATTACTTTAGCACTATGAGGAGCAGTAATAACCAGTGCCATCTGCCTACGACAAATCGACCTAAAGTC
CCTAATTGCTTACTCCTCTGTAAGCCATATAGGACTAGTCATCGCCGCAACCATAATTCAAACCCAATGA
GCCTTCTCAGGGGCAATAATCCTAATAATCTCTCACGGCCTAACCTCCTCTATACTATTCTGCCTGGCCA
ATACAAACTACGAACGAACTCACAGCCGAATCCTACTTCTAACCCGAGGACTTCAACCCCTCCTACCACT
TATGGCCACCTGATGACTACTAGCAAACCTAACAAACATGGCACTACCACCAACAACCAACCTCATAGCA
GAACTAACCATTGTAGTAGCCCTGTTCAACTGATCCCCACTGACAATCATTTTAACAGGAACTACAATCG
TACTAACTGCCTCTTATACCCTACATATGCTAATAACAACACAACGAGGAATACTACCATCCCACATCAC
CTCAATCCAAAATTCCTCAACACGAGAACATCTCCTGATGGCCCTACACATAATTCCCATAATCCTACTT
ATTCTCAAACCTGAACTAATCTCAGGAATCCCTATATGCAAGTATAGTTTAATCAAAACATTAGATTGTG
ATTCTAAAGATAGAAGTTAAACCCTTCTTACCTGCCGAGGGGAGGTTAAACCAACAAGAACTGCTAATTC
TTGCATCTGAGTATAAAACCTCAGCCCCCTTACTTTCAAAGGATAATAGTAATCCAATGGTCTTAGGAAC
CAGTCATCTTGGTGCAAATCCAAGTGAAAGTAATGGACCAAATACTTATCCTAAACACATTCATACTACT
CACCCTAGCAGTACTCTGCACCCCAATCATCTTCCCCATACTATCAAGCAGCCTAAAAAACACTCCAACT
ATCATTACAAACACTGTCAAAACTTCCTTCCTAATCAGCCTGATCCCCATAACCATCTACATTCACTCAG
GAATAGAAAGTCTAACTTCCTTCTGGGAATGAAAATTCATTATAAACTTTAAAATTCCTATCAGCCTAAC
AATAGACTTCTACTCACTGACTTTCTTCCCAATTGCCCTATTTGTCTCCTGATCAATCCTACAATTTGCA
ACATGATACATAGCCTCAGACCCGCACGTCGCAAAATTTTTCACCTTCCTCCTCCTATTCCTTATTGCCA
TGCTCATCCTGATTATCTCCAACAACCTGTTCCTACTCTTCATCGGATGAGAAGGAGTAGGAATCATATC
CTTCCTACTAATCAGCTGATGACATGGCCGAGCAGAAGCAAATACCGCTGCCCTACAGGCCGTACTATAC
AACCGAGTCGGAGATGTAGGCCTTATCCTGTGCATGGCATGACTAGCTTCCACCATAAACACATGAGAAA
TTCAACAAATCTCATCTCAGGACCAAACTCCTACCCTACCACTACTAGGCTTAATTTTAGCTGCGGCCGG
CAAATCCGCCCAATTTGGCCTCCACCCGTGACTCCCAGCAGCAATAGAAGGCCCAACCCCTGTATCCGCC
TTACTTCATTCCAGCACCATAGTAGTCGCCGGGATCTTCCTACTTATCCGAACTCACCCCCTCTTCCACA
ACAACCCCACTGCACTATCACTATGCCTATGCCTGGGAGCCCTCTCCACACTATTCGCAGCCACTTGCGC
CCTGACCCAAAATGATATCAAAAAAATCATTGCTTTTTCCACATCCAGCCAACTAGGCCTAATAATAGTT
ACAATCGGCCTAAATCTTCCCCATCTAGCCTTCCTGCATATTTCAACCCACGCATTCTTCAAAGCCATGC
TATTCCTATGTTCAGGGTCAATCATTCACAGCCTCAACGGCGAACAAGACATTCGAAAAATAGGAGGACT
TCAAAAAATACTACCAACAACAACCTCATGCCTAACTATCGGAAACCTAGCCCTGATAGGAACACCATTT
CTGGCAGGATTCTACTCCAAAGACCAAATTATCGAAAGCCTCAACACCTCGTACTTAAACGCTTGAGCCC
TAGTTCTAACTCTCCTAGCTACATCATTCACCGCAGTATATACTATTCGAATAACCCTATTAGTTCAAAC
AGGATACGTCCGAATTCCTCCCCTAACCCCCATGAACGAAAATAACCCAGCAGTCCTCTCCTCAATCACT
CGACTTGCACTAGGAAGCATTGTAGCAGGATTCCTAATCACCTCATATATTCCACCTGCAAAAACCCCAC
CAATAACTATACCACTATCCATTAAAGTCACGGCCCTTGTAGTAACACTACTAGGAATCATCCTAGCCCT
AGAACTCTCAAAACTAACTCAAGCTTTAATCCTCCCTAAACAGAATCGCTTCTCAAATTTCTCTACAGCC
CTAGGATACTTTAATCCCCTAGTACACCGATTTATCCCAACAAAAATACTAAGCGGCGGCCAAAACATTG
CCTCCCACCTAATTGACCTCTCTTGATTCAAACTTCTAGGCCCTGAAGGGTTAGCCAACCTACAAATAAT
AGCATCAAAAACCGCTACCTCCTTCCACACAGGCCTAATTAAAGCCTACCTAGGATCATTTGCCTTATCA
ATCTTTATCATCCTCCTATCCACATACAGAACCAAACTTAATGGCCCTAAATCTACGAAAAAATCACCCA
CTACTAAAAATCATCAACAACTCCCTAGTTGACCTTCCCACTCCATCAAACATTTCAGCTTGATGAAACT
TCGGATCCCTACTAGGCCTATGCCTCATCACACAAATTGTCACAGGCCTACTACTAGCCATACATTACAC
AGCAGACACCTCCCTAGCCTTCGCTTCCGTAGCCCACATATGCCGAGACGTACAATTCGGATGACTAATC
CGAAACCTCCACGCAAATGGGGCCTCCTTCTTTTTCATTTGCATCTACCTACATATTGGCCGAGGATTCT
ATTACGGCTCATACCTAAACAAAGAAACCTGAAACATTGGAGTAGTCCTTCTTCTAACACTAATAGCAAC
TGCCTTCGTAGGATACGTCCTGCCATGAGGACAAATATCTTTCTGAGGAGCTACAGTCATTACAAACCTT
TTCTCAGCAATCCCATACATTGGACAAACATTAGTAGAATGACTATGAGGCGGGTTCTCAGTAGACAACC
CCACACTAACCCGATTCTTCGCCTTCCACTTCCTCCTCCCCTTTGTAATCGCAGGCCTGACACTAGTACA
CTTAACCTTCCTCCACGAAACAGGCTCAAACAACCCACTAGGAATCCCCTCAGATTGCGACAAAATTCCA
TTCCACCCTTACTACTCCATCAAAGACCTACTAGGATTCGCACTAATACTCGTCCCATTCGTCACTCTGG
CCCTATTTTCCCCAAACCTCCTAGGAGACCCAGAAAATTTCACGCCCGCCAACCCCCTGGCCACACCTCC
CCACATTAAACCCGAATGATACTTCCTATTTGCATACGCCATTCTCCGATCCATCCCAAACAAACTAGGA
GGAGTCCTAGCTCTAGCCGCCTCAGTCCTAGTCCTATTCCTAATACCTCTCCTCCACACGTCTAAACAAC
GTTCCATAACCTTTCGACCCCTATCACAAATCCTATTCTGAGCTCTAGTCGCAGACCTCTTCATCCTAAC
ATGAGTAGGAAGCCAACCAGTCGAACACCCATTCATCATCATTGGCCAACTAGCCTCCTTCACCTACTTC
GCAATCATCCTAATCCTGTTCCCTATCGCGAGTGCACTAGAAAACAAAATACTAAAACTCTAATCAACTC
TAATAGTTTATAAAAACATTGGTCTTGTAAGCCAAAGATTGAAGACTAAACATCTTCTTAGAGTTAACAC
ATAAATCAGAAAGAAAGGAGTCAAACCTTTATCACCAACTCCCAAAGCTGGCATTCTCAATTAAACTACT
CTCTGACCTACCAATTAAACCGCCCGAATTGCCCCCCGAGATAACCCCCGCACAAGTTCTAAAACCACAA
ACAGTGTTAATAACAGGCCTCATCCTGCAATTAAAAGCAGCCCTGACCCAGACGAATAGAACATAGCTAC
TCCACTAAAATCCGTCCGAGTTCACGATAGACCTCCATTATTCACCGTATCCCCTCCCATAATCACTTCA
GAAAACACCCCTGTAGCAAACCCCACAATAACAACGACTAACCCCAGACCAACACCATAACCAACAACCC
GTCAATCACCCCAAGATTCCGGATAAGGATCCGCTGCCAGAGACACTGAATAAACAAATACCACCAGCAT
CCCCCCTAAATATACCATCACCAGTACAAGAGAAACAAAAGAAACCCCCATACTTACCAGTCACCCACAT
CCAGCAATAGAAGCCACAACCAGACCCACCACCCCATAATAAGGAGAAGGGTTAGACGCAACCGCTAACC
CTCCTAAAACAAAGCATAGACTCATAAAAAGAACAAAGTTTATCATAGTTCCTGCTTGGATCCTCCCCAA
GACCTATGGCTTGAAAAACCATTATTATAAAACTTTAACTACAGGAACTAAACCCTACTCTCATCCACCC
CCCCCCCTTACCCCCCCCATGTTTTTACATGGGATTTTGGCTATGTATTTCTTTGCATACAATTCTCGTC
CACATTAGACATAATATGCATGTAGGATAACTCACATAACAAGTAATGCAAGACCTAACCAAACTCAAAT
ATCATCGCCCATAACACCCCAAACGGACAGATAACCTTCCAGGCACATCCCCATCGCAGGCACAACAAAC
CCAGGTAATCCTACCAACGACACAAGACAAGCTTCGCCCAAGATCGAGAATGTTTTACCTTACATAACAA
CGCACTCTCGTAAACGAGGAATATCCTAGTACCCCAATGAATTCTTAATCCCATACGTTTCAGTCCATCA
CCACAAAACCTCCTAGTCCTATCACTCTCAAGAGCTCCCAAGAAGGACCTGGTTATTTATTAGTCGTAAT
CCTCACGAGAACCGAGCTACTCAACGTAGGTGCTACCCACGGCTACCAGCTTCAAGGCCATACTTTCCCC
CTACACCCTCGCCCAACTTGCGCTTTTGCGCCTCTGGTTCCTATTTCAGGGCCATAACTTGGACCTTTCC
CTCCTTATCGCTCTTCACAGATGCAAGTGGTCGGATGCATAATCCTCCCTTTGCCTCGTGATCGCGGCAT
CCGACCGACTTGGCGCTTGTTTTCTTTTTGGGGTCTCTTCATTAAACCCTTCAAGTGCGTAGCAGGAGTT
ATCTTCCTCTTGACGTGTACATCACATGGCATCCGAGCGGCTATTTGTCTGTAATGTACCTGGTGTCATG
GTTGTTCGGATAAGGTCGTCTCAAACTTGACACTGATGCACTTTTACCCCATTCATGGTGGGTCCCCCAG
CTACCTATACGGTGGCAGATAATGTTATGGTTGCCGGACATAGTTTGTTATTTTTCCTTTACTAGGAATT
ATCACCCAAACCTTCATTTTCATTCTTTTTTTTATCGTTTATTTTTATGTTGTAATTTTAACAAAATAAA
CAACAACTTTTATATGATATTAACCTAGATTTTCCAAACCATTCATCGTTCGTTCATTAACACTTAACTT
TCCTCTGCCTTTCCCCTATTTTTAACCCAACAAATCAATGACTTTCATCATAACTTCCACAACCACCAAC
TTAGCCAAATTACACAAAACAAACAAACCAATTAAAAACAAGATAAAAGTACACACCCTTTACACACAAC
CACACTAAACACACAACAAAACTTAACACACTATATGCCACAATACTACTTTTCATTTATAAAAAAAACA
AGATAAAAATACAAAACATCAATACCAATAATAAGTCCAAAATACTACATTCGCTT